Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
(7-methoxycoumarin-4-yl)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
?
-
Substrates: fluorogenic synthetic substrate
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2 + H2O
?
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Ser-Ala-Phe-Leu-Ala-Phe-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide + H2O
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu + L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
-
Substrates: due to the close proximity of a Mca-donor and a Dnp-acceptor, near complete intramolecular quenching effect is achieved in the substrate's intact state. After the proteolytic cleavage of the hydrophobic motif, both Mca and Dnp are further apart, resulting in bright fluorescence
Products: substrate shows a 265fold difference in the net fluorescence signals between cathepsins E and D. This cathepsin E selectivity is established by having Leu-Pro residues at the scissile peptide bond
?
Acetyl-substance P + H2O
?
-
Substrates: -
Products: -
?
Acetyl-substance P(2-11) + H2O
?
-
Substrates: -
Products: -
?
Acetyl-substance P(3-11) + H2O
?
-
Substrates: -
Products: -
?
acidic fibroblast growth factor + H2O
?
-
Substrates: -
Products: -
?
Acidic fibroblast growth factor fragment 102-111 + H2O
His-Ala-Glu-Lys-His-Trp-Phe + Val-Gly-Leu
antigens presented by MHC class II molecules + H2O
?
-
Substrates: -
Products: -
?
Arg-modified substance P + H2O
?
-
Substrates: -
Products: -
?
Basic fibroblast growth factor fragment 106-120 + H2O
?
Bovine gamma-globulin + H2O
Hydrolyzed bovine gamma-globulin
Bovine serum albumin + H2O
?
-
Substrates: -
Products: -
?
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
casein + H2O
hydrolyzed casein
Cholecystokinin 8 + H2O
Asp-Tyr-Met-Gly-Trp + Met-Asp-Phe-NH2
Cytochrome c + H2O
Hydrolyzed cytochrome c
-
Substrates: pH 5, at 2.5% (dimeric enzyme) or 2.3% (monomeric enzyme) the rate of hemoglobin hydrolysis
Products: -
?
DED-[5-[(2-aminoethyl)amino]naphthalene-1-sulfonyl]-KPILFFRLGK-[4-(4-dimethylaminophenylazo)benzoic acid] + H2O
?
-
Substrates: -
Products: -
?
dynorphin A + H2O
hydrolyzed dynorphin A
Egg albumin + H2O
Hydrolyzed egg albumin
Eledoisin + H2O
Pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe + Ile-Gly-Leu-Met-NH2
glucagon + ATP + H2O
hydrolyzed glucagon + ?
-
Substrates: is digested at pH 4.0 but not at pH 7.4
Products: -
?
Hemoglobin + H2O
?
-
Substrates: denatured
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
Human beta-endorphin + H2O
Hydrolyzed human beta-endorphin
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
Human endothelin precursor big ET-2 + H2O
Human endothelin precursor ET-2 + respective C-terminal fragment
-
Substrates: cleavage site: Trp-Val
Products: -
?
Human endothelin precursor big ET-3 + H2O
Huamn endothelin precursor ET-3 + respective C-terminal fragment
-
Substrates: cleavage site: Trp-Ile
Products: -
?
Human gamma-globulin + H2O
Hydrolyzed human gamma-globulin
-
Substrates: pH 5, at 0.5% (dimeric enzyme) or 0.6% (monomeric enzyme) the rate of hemoglobin hydrolysis
Products: -
?
Human renin substrate + H2O
Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Val-Ile-His
Immunoglobulin + H2O
?
-
Substrates: least active gastric protease for this substrate
Products: -
?
Kassinin + H2O
Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe + Val-Gly-Leu-Met-NH2
Lys-Pro-Ala-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ala-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: -
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
Membrane proteins + H2O
?
-
Substrates: -
Products: -
?
MOCAc-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(DnP)-D-Arg-NH2 + H2O
?
Substrates: -
Products: -
?
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: -
Products: -
?
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
Substrates: -
Products: -
?
MOCAc-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: -
Products: -
?
MOCAc-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(DNP)-D-Arg-NH2 + H2O
hydrolyzed MOCAc-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(DNP)-D-Arg-NH2
-
Substrates: -
Products: -
?
N-succinyl-Arg-Pro-Phe-His-Leu-Leu-Val-Tyr-4-methyl-7-coumaryl-amide + H2O
?
Substrates: -
Products: -
?
Neurokinin A + H2O
His-Lys-Thr-Asp-Ser-Phe + Val-Gly-Leu-Met-NH2
neurotensin + H2O
hydrolyzed neurotensin
-
Substrates: no cleavage at pH 7.4
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
Porcine renin substrate + H2O
Acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Leu-Val-Tyr-Ser
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
Pro-Thr-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Thr-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: -
Products: -
?
Reduced and carboxymethylated bovine pancreatic ribonuclease A + H2O
Hydrolyzed bovine pancreatic RCm ribonuclease A
-
Substrates: -
Products: -
?
reduced carboxymethylated(RCm-)ribonuclease A + H2O
?
-
Substrates: -
Products: -
?
renin + H2O
?
-
Substrates: -
Products: -
?
Substance P + H2O
Arg-Pro-Lys-Pro-Gln-Gln-Phe + Phe-Gly-Leu-Met-NH2
Substance P(1-9) + H2O
?
-
Substrates: -
Products: -
?
Substance P(2-11) + H2O
?
-
Substrates: -
Products: -
?
Substance P(3-11) + H2O
?
-
Substrates: -
Products: -
?
Substance P(4-11) + H2O
?
-
Substrates: -
Products: -
?
[His10]-substance P + H2O
?
-
Substrates: -
Products: -
?
[Tyr8]-substance P + H2O
?
-
Substrates: -
Products: -
?
additional information
?
-
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: most sensitive and selective substrate for cathepsin E. This substrate might represent a useful tool for monitoring and accurately quantifying cathepsin E, even in crude enzyme preparations
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: -
Products: -
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
-
Substrates: most sensitive and selective substrate for cathepsin E. This substrate might represent a useful tool for monitoring and accurately quantifying cathepsin E, even in crude enzyme preparations
Products: -
?
Acidic fibroblast growth factor fragment 102-111 + H2O
His-Ala-Glu-Lys-His-Trp-Phe + Val-Gly-Leu
-
Substrates: i.e. His-Ala-Glu-Lys-His-Trp-Phe-Val-Gly-Leu or acidic FGF 102-111
Products: -
?
Acidic fibroblast growth factor fragment 102-111 + H2O
His-Ala-Glu-Lys-His-Trp-Phe + Val-Gly-Leu
-
Substrates: i.e. His-Ala-Glu-Lys-His-Trp-Phe-Val-Gly-Leu or acidic FGF 102-111
Products: -
?
Basic fibroblast growth factor fragment 106-120 + H2O
?
-
Substrates: i.e. Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-Ala-Leu-Lys-Arg or basic FGF 106-120, major cleavage site: Tyr-Val, minor site: Trp-Tyr
Products: -
?
Basic fibroblast growth factor fragment 106-120 + H2O
?
-
Substrates: i.e. Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-Ala-Leu-Lys-Arg or basic FGF 106-120, major cleavage site: Tyr-Val, minor site: Trp-Tyr
Products: -
?
big ET-1 + H2O
?
-
Substrates: -
Products: -
?
big ET-1 + H2O
?
-
Substrates: -
Products: -
?
Bovine gamma-globulin + H2O
Hydrolyzed bovine gamma-globulin
-
Substrates: -
Products: -
?
Bovine gamma-globulin + H2O
Hydrolyzed bovine gamma-globulin
-
Substrates: pH 2.5, at 2.3% the rate of hemoglobin hydrolysis
Products: -
?
Bovine gamma-globulin + H2O
Hydrolyzed bovine gamma-globulin
-
Substrates: -
Products: -
?
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
-
Substrates: -
Products: -
?
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
-
Substrates: pH 5, at 3.6% (dimeric enzyme) or 4.1% (monomeric enzyme) the rate of hemoglobin hydrolysis
Products: -
?
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
-
Substrates: -
Products: -
?
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
-
Substrates: pH 2.5 at 14% the rate of hemoglobin hydrolysis
Products: -
?
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
-
Substrates: -
Products: -
?
casein + H2O
hydrolyzed casein
-
Substrates: -
Products: -
?
casein + H2O
hydrolyzed casein
-
Substrates: pH 5, at 9.1% (dimeric enzyme) or 8.9% (monomeric enzyme) the rate of hemoglobin hydrolysis
Products: -
?
casein + H2O
hydrolyzed casein
-
Substrates: -
Products: -
?
casein + H2O
hydrolyzed casein
-
Substrates: at pH 5.5
Products: -
?
casein + H2O
hydrolyzed casein
-
Substrates: at 2.3% the rate of hemoglobin hydrolysis
Products: -
?
casein + H2O
hydrolyzed casein
-
Substrates: -
Products: -
?
Cholecystokinin 8 + H2O
Asp-Tyr-Met-Gly-Trp + Met-Asp-Phe-NH2
-
Substrates: i.e. Asp-Tyr-Met-Gly-Trp-Met-Asp-Phe-NH2, cleavage site: Trp-Met
Products: -
?
Cholecystokinin 8 + H2O
Asp-Tyr-Met-Gly-Trp + Met-Asp-Phe-NH2
-
Substrates: i.e. Asp-Tyr-Met-Gly-Trp-Met-Asp-Phe-NH2, cleavage site: Trp-Met
Products: -
?
dynorphin A + H2O
hydrolyzed dynorphin A
-
Substrates: cleavage site: Phe4-Leu5
Products: -
?
dynorphin A + H2O
hydrolyzed dynorphin A
-
Substrates: no cleavage at pH 7.4
Products: -
?
dynorphin A + H2O
hydrolyzed dynorphin A
-
Substrates: cleavage site: Phe4-Leu5
Products: -
?
Egg albumin + H2O
Hydrolyzed egg albumin
-
Substrates: pH 5, at 1% (dimeric enzyme) or 1.1% (monomeric enzyme) the rate of hemoglobin hydrolysis
Products: -
?
Egg albumin + H2O
Hydrolyzed egg albumin
-
Substrates: i.e. ovalbumin
Products: -
?
Eledoisin + H2O
Pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe + Ile-Gly-Leu-Met-NH2
-
Substrates: i.e. pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe-Ile-Gly-Leu-Met-NH2, cleavage site: Phe-Ile
Products: -
?
Eledoisin + H2O
Pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe + Ile-Gly-Leu-Met-NH2
-
Substrates: i.e. pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe-Ile-Gly-Leu-Met-NH2, cleavage site: Phe-Ile
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: -
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: preferred substrate
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: at pH 2 the two catalytically active subunits have the same activity vs. hemoglobin, but at pH 5 they have a slightly higher activity than the enzyme dimer
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: -
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: acid denatured form
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: bovine
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: preferred substrate
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: -
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: acid denatured form
Products: -
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
-
Substrates: bovine
Products: -
?
Human beta-endorphin + H2O
Hydrolyzed human beta-endorphin
-
Substrates: major cleavage site: Leu17-Phe18, minor site: Thr16-Leu17
Products: -
?
Human beta-endorphin + H2O
Hydrolyzed human beta-endorphin
-
Substrates: major cleavage site: Leu17-Phe18, minor site: Thr16-Leu17
Products: -
?
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
-
Substrates: cleavage site: Trp-Val
Products: -
?
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
-
Substrates: cleavage site: Trp-Val
Products: -
?
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
-
Substrates: cleavage site: Trp-Val
Products: -
?
Human renin substrate + H2O
Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Val-Ile-His
-
Substrates: i.e. angiotensinogen fragment 1-13 or Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu-Val-Ile-His, cleavage site: Leu-Val
Products: -
?
Human renin substrate + H2O
Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Val-Ile-His
-
Substrates: i.e. angiotensinogen fragment 1-13 or Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu-Val-Ile-His, cleavage site: Leu-Val
Products: -
?
Kassinin + H2O
Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe + Val-Gly-Leu-Met-NH2
-
Substrates: i.e. Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe-Val-Gly-Leu-Met-NH2, cleavage site: Phe-Val
Products: -
?
Kassinin + H2O
Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe + Val-Gly-Leu-Met-NH2
-
Substrates: i.e. Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe-Val-Gly-Leu-Met-NH2, cleavage site: Phe-Val
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: synthetic chromogenic peptide, less suitable peptide substrate than substance P or other tachykinins
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: -
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: synthetic chromogenic peptide, less suitable peptide substrate than substance P or other tachykinins
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: pH 7.4
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: no activation by ATP
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: -
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: synthetic chromogenic peptide, less suitable peptide substrate than substance P or other tachykinins
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: -
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: synthetic chromogenic peptide, less suitable peptide substrate than substance P or other tachykinins
Products: -
?
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: i.e. RS-6
Products: -
?
Neurokinin A + H2O
His-Lys-Thr-Asp-Ser-Phe + Val-Gly-Leu-Met-NH2
-
Substrates: i.e. His-Lys-Thr-Asp-Ser-Phe-Val-Gly-Leu-Met-NH2, cleavage site: Phe-Val
Products: -
?
Neurokinin A + H2O
His-Lys-Thr-Asp-Ser-Phe + Val-Gly-Leu-Met-NH2
-
Substrates: i.e. His-Lys-Thr-Asp-Ser-Phe-Val-Gly-Leu-Met-NH2, cleavage site: Phe-Val
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
-
Substrates: cleavage sites
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
-
Substrates: -
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
-
Substrates: cleavage sites
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
-
Substrates: no activation by ATP
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
-
Substrates: cleavage specificity changes significantly with pH, e.g. cleaves Glu13-Ala14 only at pH 7.4
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
-
Substrates: cleavage sites
Products: -
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
-
Substrates: cleavage sites
Products: -
?
Porcine renin substrate + H2O
Acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Leu-Val-Tyr-Ser
-
Substrates: i.e. angiotensinogen fragment 1-14 acetate salt or acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu-Leu-Val-Tyr-Ser, cleavage site: Leu-Leu
Products: -
?
Porcine renin substrate + H2O
Acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Leu-Val-Tyr-Ser
-
Substrates: i.e. angiotensinogen fragment 1-14 acetate salt or acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu-Leu-Val-Tyr-Ser, cleavage site: Leu-Leu
Products: -
?
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: -
Products: -
?
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: -
Products: -
?
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: synthetic chromogenic peptide
Products: -
?
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
-
Substrates: synthetic chromogenic peptide
Products: -
?
Substance P + H2O
Arg-Pro-Lys-Pro-Gln-Gln-Phe + Phe-Gly-Leu-Met-NH2
-
Substrates: i.e. Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2, best peptide substrate, cleavage site: Phe-Phe
Products: -
?
Substance P + H2O
Arg-Pro-Lys-Pro-Gln-Gln-Phe + Phe-Gly-Leu-Met-NH2
-
Substrates: i.e. Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2, best peptide substrate, cleavage site: Phe-Phe
Products: -
?
Substance P + H2O
Arg-Pro-Lys-Pro-Gln-Gln-Phe + Phe-Gly-Leu-Met-NH2
-
Substrates: i.e. Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2, best peptide substrate, cleavage site: Phe-Phe
Products: -
?
Substance P + H2O
Arg-Pro-Lys-Pro-Gln-Gln-Phe + Phe-Gly-Leu-Met-NH2
-
Substrates: i.e. Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2, best peptide substrate, cleavage site: Phe-Phe
Products: -
?
Tachykinins + H2O
?
-
Substrates: -
Products: -
?
Tachykinins + H2O
?
-
Substrates: -
Products: -
?
Tachykinins + H2O
?
-
Substrates: -
Products: -
?
Tachykinins + H2O
?
-
Substrates: -
Products: -
?
additional information
?
-
-
Substrates: no hydrolysis of synthetic peptides corresponding to residues His16-His27 and His16-Ser38 in the big ET-1 sequence
Products: -
?
additional information
?
-
-
Substrates: milk-clotting activity is twice as high as that of pepsinogen and gastricin
Products: -
?
additional information
?
-
-
Substrates: degradation of protein antigens, crucial step in the initiation of a T-cell mediated immune response
Products: -
?
additional information
?
-
-
Substrates: cathepsin E has an important role in the class II MHC Ag processing pathway within dendritic cells
Products: -
?
additional information
?
-
-
Substrates: cathepsin E has an important role in the class II MHC Ag processing pathway within dendritic cells
Products: -
?
additional information
?
-
-
Substrates: cathepsin E is located in mast-cell secretory granules in complex with heparin proteoglycans, and has a role in processing of procarboxypeptidase A into active protease
Products: -
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
(D)-His-Pro-Phe-His-Leu-PSI(CH2-NH)-Leu-Val-Tyr
1,2-epoxy-3-(p-nitrophenoxy)propane
alpha2-Macroglobulin
-
at pH 5.5, RNAse as substrate, at a molar ratio of enzyme/inhibitor of 0.5:1 to 2:1, above a ratio of 2:1 the excess enzyme is not inhibited, structural changes in alpha2-macroglobulin upon complex formation, no inhibition with oxidized insulin B-chain as substrate
-
Ascaris pepsin inhibitor
-
CCACCAACACAACTAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 4.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAACAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 31.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAACGAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 14.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAATAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCATCACTACAACAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCATAGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 22.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCATAGTGCTCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 6.2% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCCCACCACAACCCTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 37.6% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCCCACCACAACCCTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
DGCCIIINGGRPPTVFFRVKDYKHHDDK
-
Diazoacetyl-DL-norleucine methyl ester
GGSCSSCLGGRPPTIFFRLKDYKDDDDK
-
grassystatin A
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
grassystatin B
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
grassystatin C
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
N-tert-Butoxycarbonyl-His-Pro-Phe-His-Leu-PSI(CHOH-CH2)-Val-Ile-His
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Nle-Arg-Leu
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Phe-Arg-Glu
Protein inhibitor from Ascaris lumbricoides
-
SCIGIIDSGGRPPTIFFRAEGLQR
-
TCCATAAGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.2% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGAATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 26.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGATTCACTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.7% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGCTCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 24.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGTCACTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 18.4% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGTATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 15.4% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGAGCTCACTCATCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 27.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGAGCTCACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGTGCTCACTTATCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 19.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TGCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 40.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TTCATATGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TTCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 29.7% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
YCGGLLPLGGRPPTIFFRLKDYKGDDDK
-
(D)-His-Pro-Phe-His-Leu-PSI(CH2-NH)-Leu-Val-Tyr
-
i.e. H-77, with reduced isostere as replacement of the-CO-NH- of the peptide bond
(D)-His-Pro-Phe-His-Leu-PSI(CH2-NH)-Leu-Val-Tyr
-
i.e. H-77, with reduced isostere as replacement of the-CO-NH- of the peptide bond
1,2-epoxy-3-(p-nitrophenoxy)propane
-
ir
1,2-epoxy-3-(p-nitrophenoxy)propane
-
ir
1,2-epoxy-3-(p-nitrophenoxy)propane
-
ir
1,2-epoxy-3-(p-nitrophenoxy)propane
-
ir
Ascaris pepsin inhibitor
-
-
-
Ascaris pepsin inhibitor
-
-
-
Ascaris pepsin inhibitor
-
-
-
Diazoacetyl-DL-norleucine methyl ester
-
ir
Diazoacetyl-DL-norleucine methyl ester
-
ir
Diazoacetyl-DL-norleucine methyl ester
-
ir
Diazoacetyl-DL-norleucine methyl ester
-
ir
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
-
-
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
-
i.e. L-363,564, hemoglobin as substrate
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
-
-
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
-
-
N-tert-Butoxycarbonyl-His-Pro-Phe-His-Leu-PSI(CHOH-CH2)-Val-Ile-His