Any feedback?
Please rate this page
(search_result.php)
(0/150)

BRENDA support

Refine search

Search Inhibitors

show results
Don't show organism specific information (fast!)
Search organism in taxonomic tree (slow, choose "exact" as search mode, e.g. "mammalia" for rat,human,monkey,...)
(Not possible to combine with the first option)
Refine your search
Image of 2D Structure
Search for synonyms (with exact matching search term)

Search term:

Results 1 - 10 of 64 > >>
EC Number Inhibitors Commentary Structure
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34(D)-His-Pro-Phe-His-Leu-PSI(CH2-NH)-Leu-Val-Tyr i.e. H-77, with reduced isostere as replacement of the-CO-NH- of the peptide bond Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.341,2-epoxy-3-(p-nitrophenoxy)propane ir Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34alpha2-Macroglobulin at pH 5.5, RNAse as substrate, at a molar ratio of enzyme/inhibitor of 0.5:1 to 2:1, above a ratio of 2:1 the excess enzyme is not inhibited, structural changes in alpha2-macroglobulin upon complex formation, no inhibition with oxidized insulin B-chain as substrate Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34Ascaris pepsin inhibitor - Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34CCACCAACACAACTAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 4.5% inhibition (2 nM inhibitor /2 nM cathepsin E) Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34CCACCACCACAACAAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 31.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34CCACCACCACAACGAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 14.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34CCACCACCACAATAAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.5% inhibition (2 nM inhibitor /2 nM cathepsin E) Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34CCATCACTACAACAAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.4.23.34CCCATAGGGATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 22.3% inhibition (2 nM inhibitor /2 nM cathepsin E) Go to the Ligand Summary Page
Results 1 - 10 of 64 > >>