Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 3.4.23.34 extracted from

  • Yoshida, C.; Kuniwake, A.; Naimuddin, M.; Nishigaki, K.
    Molecular design guided by a local map of sequence space: DNA aptamers that inhibit cathepsin E (2008), Oligonucleotides, 18, 1-8.
    View publication on PubMed
Search for more literature for 3.4.23.34

Inhibitors

Inhibitors Comment Organism Structure
CCACCAACACAACTAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 4.5% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCACCACCACAACAAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 31.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCACCACCACAACGAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 14.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCACCACCACAATAAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.5% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCATCACTACAACAAAACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCCATAGGGATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 22.3% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCCATAGTGCTCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 6.2% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCCCCACCACAACCCTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 37.6% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
CCCCCACCACAACCCTCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.3% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCATAAGGATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.2% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCATAGGAATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 26.8% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCATAGGGATTCACTCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.7% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCATAGGGCTCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 24.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCATAGGGTCACTCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 18.4% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCATAGGTATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.8% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCATCGGGATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 15.4% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCCCGGAGCTCACTCATCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 27.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCCCGGAGCTCACTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.5% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TCCCCGGTGCTCACTTATCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 19.3% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TGCATCGGGATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 40.8% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TTCATATGGATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.0% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus
TTCATCGGGATCACTCCCTCCAC inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 29.7% inhibition (2 nM inhibitor /2 nM cathepsin E) Rattus norvegicus

Organism

Organism UniProt Comment Textmining
Rattus norvegicus
-
-
-

Source Tissue

Source Tissue Comment Organism Textmining
spleen
-
 Rattus norvegicus
-

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
-
 Rattus norvegicus ?
-
 ?

Synonyms

Synonyms Comment Organism
cathepsin E
-
 Rattus norvegicus