Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
25S pre-rRNA + H2O
25S rRNA
35S pre-rRNA + H2O
mature 35S rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
515 bp dsRNA + H2O
?
-
Dicer-2 substrate is synthetic 515 bp dsRNA
-
-
?
Aa-[16S[micro-hp]RNA] + H2O
?
-
structures of the Aquifex pre-16S and pre-23S rRNA processing stems and corresponding hairpin substrates, overview
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
double-stranded RNA + H2O
?
ds-rRNA + H2O
mature ds-rRNA
dsRNA + H2O
processed RNA
hairpin RNA R1.1 + H2O
?
-
RNase III(E38A) cleaves at the primary site and remains bound to the RNA, thereby preventing cleavage at the secondary site
-
-
?
mature 23S rRNA
23S pre-rRNA + H2O
-
-
-
-
?
mraZ mRNA + H2O
?
the degradation of mraZ mRNA is performed by RNase III and the 3'-to-5' exoribonuclease, PNPase. The cleavage site for mraZ mRNA by RNase III is in the coding region
-
-
?
mRNA + H2O
mature mRNA
-
specific processing of several hairpin nemis+, i.e. Neisseria miniature insertion sequences, mini transcripts, enzyme/substrate interaction, substrate specificity, overview
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
poly(A)-poly(U) + H2O
5'-phosphooligonucleotides
-
-
-
-
?
poly(I C) + H2O
5'-phosphooligonucleotides
-
-
-
-
?
poly(IC) + H2O
?
-
-
-
-
?
pre-16S rRNA + H2O
mature 16S rRNA
-
-
-
-
?
pre-23S rRNA + H2O
mature 23S rRNA
pre-5S rRNA + H2O
mature 5S rRNA
-
-
-
-
?
pre-mRNA + H2O
mature mRNA
pre-rRNA + H2O
mature rRNA
pre-snoRNA + H2O
mature snoRNA
pre-snRNA + H2O
mature snRNA
premicro-RNA + H2O
mature micro-RNA
-
RNase III treatment causes a preferential loss of RNA in the 50- to 100-nt region. After RNase III treatment, the ratio of pre- to mature micro-RNA is reduced for micro-RNAs such as hsa-let-7b and hsa-let-7g, in both conditioned medium and mesenchymal stem cells due to a decrease in premicro-RNA level coupled with a concomitant increase in mature micro-RNA level
-
-
?
R1.1 RNA + H2O
2 fragment of R1.1 RNA
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
2 fragments of R1.1 RNA
R1.1 RNA + H2O
fragments of R1.1 RNA
R1.1 RNA derivatives + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, derivative R1.1[CL3B] is not cleaved and its binding to the enzyme leads to uncoupling of substrate recognition and cleavage
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
RNA precursor + H2O
mature RNA
-
phage lambda RNA, enzyme is involved in translation control
-
-
?
RNA substituted with guanosine 5'-O-(1-thiotriphosphate) + H2O
5'-phosphooligonucleotides containing guanosine 5'-O-(1-thiotriphosphate)
-
cleavage specificity is not altered by modified RNA
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
synthetic 25S rRNA 3' ETS cleavage site containing RNA + H2O
?
-
-
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
additional information
?
-
25S pre-rRNA + H2O
25S rRNA
-
-
-
-
?
25S pre-rRNA + H2O
25S rRNA
-
processing
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for processing of dsRNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
responsible for processing and maturation of RNA precursors into functional rRNA, mRNA and other small RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves scRNA, similar to signal recognition particle
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
15 bases in average
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
no activity on DNA-RNA hybrids
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
134334, 134335, 134336, 134337, 134338, 134339, 134340, 134341, 134342, 134343, 134345, 134346, 134348, 134349, 134351, 134352, 134353, 134354, 134357, 134358, 134359, 134360, 134361, 134362, 134364, 134365 -
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
Dicer is a multidomain ribonuclease that processes double-stranded RNAs (dsRNAs) to 21 nt small interfering RNAs (siRNAs) during RNA interference, and excises microRNAs from precursor hairpins. Dicer contains two domains related to the bacterial dsRNA specific endonuclease, RNase III, which is known to function as a homodimer. Enzyme has only one processing center, containing two RNA cleavage sites and generating products with 2 nt 3' overhangs. It is proposed that Dicer functions through intramolecular dimerization of its two RNase III domains, assisted by the flanking RNA binding domains, PAZ and dsRBD
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
RNase D activity in HIV-1 RT is contamination
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
reverse transcriptase of HIV-1 possesses RNase D activity
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
reverse transcriptase of HIV-1 possesses RNase D activity
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
Dicer is a multidomain ribonuclease that processes double-stranded RNAs (dsRNAs) to 21 nt small interfering RNAs (siRNAs) during RNA interference, and excises microRNAs from precursor hairpins. Dicer contains two domains related to the bacterial dsRNA specific endonuclease, RNase III, which is known to function as a homodimer. Enzyme has only one processing center, containing two RNA cleavage sites and generating products with 2 nt 3' overhangs. It is proposed that Dicer functions through intramolecular dimerization of its two RNase III domains, assisted by the flanking RNA binding domains, PAZ and dsRBD
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
involved in the production of short interfering RNAs (siRNAs) and for the processing of precursor miRNAs (pre-miRNAs) into microRNAs (miRNAs)
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for the production of short interfering RNAs and microRNAs that induce gene silencing known as RNA interference
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
114 bp in length
products shorter than 21 bp
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
the enzyme is able to process rRNAs and to regulate the levels of polynucleotide phosphorylase
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
processing of precursor dsRNAs into mature microRNAs and small-interfering RNAs
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
in vitro dsRNA cleavage assay with a designed 52-nt stem-loop RNA containing a 24-bp stem capped by a GCAA tetraloop as the substrate
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
the enzymatic activity requires a conserved catalytic domain, while RNA binding requires the double-stranded RNA-binding domain at the C-terminus of the protein. Rnt1p specifically cleaves RNAs that possess short irregular stem-loops containing 1214 base pairs interrupted by internal loops and bulges and capped by conserved AGNN tetraloops. A new carboxy-terminal helix following a canonical ds double-stranded RNA-binding domain structure allows the Rnt1p double-stranded RNA-binding domain to bind to short RNA stem-loops by modulating the conformation of helix a1, a key RNA-recognition element of the double-stranded RNA-binding domain
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
the observed interactions between helix alpha1 in the double-stranded RNA binding domain RNA complex in vitro are required for substrate recognition in the context of the entire protein in vivo. The endonuclease domain of Rnt1p is almost immediately N-terminal to the helix alpha1
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, preferred substrate contains NGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops, new form of Rnt1p substrates identified lacking the conserved AGNN sequence but instead harboring an AAGU tetraloop was found at the 5' end of snoRNA 48 precursor
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
new form of Rnt1p substrates identified harboring an AAGU tetraloop at the 5' end of snoRNA 48 precursor, reactions performed under low salt (10 mM KCl) and physiological salt (150 mM KCl) conditions, construction of substrate containing a AAAU or UUGU structure instead of AAGU showed similar efficiency under low salt conditions but strongly reduced efficiency under physiological salt conditions, stem structure is found to partially contribute t the substrate binding efficiency
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
enzyme plays multiple roles in the processing of rRNA and mRNA and strongly affects the decay of the sRNA MicA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
dsRNA-specific endonuclease activity enhances the RNA-silencing suppression activity of another protein (p22) encoded by SPCSV. RNase3 and p22 coexpression reduce siRNA accumulation more efficiently than p22 alone in Nicotiana benthamiana leaves expressing a strong silencing inducer (i.e., dsRNA). RNase3 does not cause intracellular silencing suppression or reduce accumulation of siRNA in the absence of p22 or enhance silencing suppression activity of a protein encoded by a heterologous virus
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
?
-
RNA 5, a 30 base stem-loop RNA of the sequence 5 '-AUAAAGGUCAUUCGCAAGAGUGGCCUUUAU-3', is cleaved by RNase III (D44N) from Aquifex aeolicus. The products of the reaction include a dinucleotide 5'-AU-3' and a 28 base stem-loop RNA with a two-base 3' overhang (RNA 6). Two RNA 6 molecules and a dimeric mutant enzyme D44N molecule form a product complex
-
-
?
double-stranded RNA + H2O
?
-
R1.1 RNA
-
-
?
double-stranded RNA + H2O
?
2'-hydroxyl groups of nucleotides of the tetraloop or adjacent base pairs are predicted to interact with residues of alpha-helix 1 are important for Rnt1p cleavage in vitro
-
-
?
ds-rRNA + H2O
mature ds-rRNA
-
-
-
-
?
ds-rRNA + H2O
mature ds-rRNA
-
double-strand RNA specific endonuclease
-
-
?
ds-rRNA + H2O
mature ds-rRNA
-
-
-
-
?
dsDNA + H2O
?
-
-
-
?
dsRNA + H2O
?
-
cleavage to short RNA pieces
-
-
?
dsRNA + H2O
?
-
RNase III(E38A) generates discrete-sized products from long dsRNA
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors in to mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
-
-
?
dsRNA + H2O
mature RNA
-
-
-
?
dsRNA + H2O
mature RNA
-
-
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
-
-
-
?
dsRNA + H2O
mature RNA
-
enzyme is involved in the maturation and decay of cellular, phage and plasmid RNAs
-
-
?
dsRNA + H2O
mature RNA
-
enzyme plays a key role in diverse maturation and degradation processes
-
-
?
dsRNA + H2O
mature RNA
-
obligatory step in the maturation and decay of diverse RNAs
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modificatin of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
double-strand RNA-specific, the dsRNA-binding domain is important for substrate binding but not for catalytic activity, while the catalytic domain is important for catalytic activity but not for substrate binding
-
-
?
dsRNA + H2O
mature RNA
-
one functional monomer is sufficient for cleavage activity of the dimer
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modificatin of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
Paramecium bursaria Chlorella virus-1
-
model substrate
product determination
-
?
dsRNA + H2O
mature RNA
-
double-strand RNA specific endonuclease
-
-
?
dsRNA + H2O
mature RNA
-
diverse model RNA substreates, enzyme cleaves specifically RNA stems capped with the conserved AGNN tetraloop, the dsRNA sequence adjacent to the tetraloop regulates enzyme activity by interfering with substrate binding, sequences surrounding the cleavage site directly influence the cleavage efficiency, a minimum substrate length is required
-
-
?
dsRNA + H2O
mature RNA
-
specific for double-stranded RNA, a dimerization signal within the N-terminal domain is required for efficient cleavage
-
-
?
dsRNA + H2O
mature RNA
-
process double-stranded RNAs consisting of two turns of the RNA helix. Although the enzyme plays a role in ribosomal RNA processing and gene regulation, enzyme is not essential for cell growth but regulates virulence gene expression
-
-
?
dsRNA + H2O
mature RNA
members of tRNase III family, which have been implicated in the processing of pre-rRNA, rRNA, polycistronic mRNAs, and small regulatory RNAs, normally cleave duplex segments of RNAs configured as stem-loop structures and are ubiquitous among prokaryotes, eukaryotes, and archaea
-
-
?
dsRNA + H2O
processed RNA
-
-
-
-
?
dsRNA + H2O
processed RNA
-
specific for double-stranded RNA
enzyme produces 12-15 base pair duplex products with 5'-phosphate, 3'-hydroxyl termini
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
mRNA phage SP82 is cleaved by Bacillus subtilis
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
mRNA phage SP82 is not cleaved by E. coli RNase III
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
reduces expression of itself
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
mRNA phage SP82 is not cleaved by E. coli RNase III
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
RNAI, a regulator of plasmid replication is cleaved
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
to affect gene expression
-
-
?
pre-23S rRNA + H2O
mature 23S rRNA
-
-
-
?
pre-23S rRNA + H2O
mature 23S rRNA
-
-
-
-
?
pre-mRNA + H2O
mature mRNA
-
-
-
-
?
pre-mRNA + H2O
mature mRNA
-
enzyme regulates gene expression by controlling mRNA translation and stability
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
enzyme is required for processing
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
-
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
enzyme is required for processing
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
-
-
-
?
pre-snRNA + H2O
mature snRNA
-
enzyme is required for processing
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
R1.1 RNA + H2O
2 fragments of R1.1 RNA
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
2 fragments of R1.1 RNA
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early regionbetween genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
?
-
-
-
-
?
R1.1 RNA + H2O
?
internally 32P-labeled R1.1
-
-
?
R1.1 RNA + H2O
?
R1.1 is a structured 60 nucleotides (nt)-long RNA molecule containing an asymmetric (4 nt/5 nt) internal loop, and it comes from the phage T7 early region between genes 1.0 and 1.1. This RNA contains an RNase III primary cleavage site (a) that is recognized in vivo and in vitro, and a secondary site (b) that is cleaved only in vitro. RNase III is known to cleave R1.1 at these two preferred sites (a and b) in a metal cofactor-dependent manner. Strictly metal cofactor-dependent activity of SmRNase III on the model R1.1 substrate
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, recombinant substrate from in vitro transcription, determination of cleaving positions for the recombinant hybrid enzyme mutants
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, several derivatives containing an internal loop
product determination
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, substrate possesses 2 ethidium bromide binding sites in the internal loop and the lower stem, respectively, both consisting of an A-A pair stacked on a CG pair, which is a motif that is a favourable environment for intercalation
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
Paramecium bursaria Chlorella virus-1
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, several cleavage sites
product determination
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, recombinant substrate from in vitro transcription, determination of cleaving positions for the recombinant hybrid enzyme mutants
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
-
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
no activity on 23S RNA and 16S RNA
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
the small and stable 10Sa RNA is cleaved
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
7S RNA is cleaved
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
23S RNA in Rhodobacter capsulatus
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
initiates maturation of 23S and 16S RNA species
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
23S RNA in Rhodobacter capsulatus
-
-
?
RNA + H2O
?
-
-
-
-
?
RNA + H2O
?
RNA substrate tested are U5, U2, Mig2, and Yta6. Comparison between the association and dissociation kinetics of Mig2 and U5 products indicated that Mig2 products have a 2fold higher association rate and an 8fold lower dissociation rate. The reactivity of Rnt1p substrates is defined by the basepairing of the cleavage site, substrate specificity, overview
-
-
?
RNA + H2O
?
RNA substrate tested are U5, U2, Mig2, and Yta6. Comparison between the association and dissociation kinetics of Mig2 and U5 products indicated that Mig2 products have a 2fold higher association rate and an 8fold lower dissociation rate. The reactivity of Rnt1p substrates is defined by the basepairing of the cleavage site, substrate specificity, overview
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
E. coli infected with bacteriophage T4 deletion mutant
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
no activity on yeast tRNA
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
initiates maturation of phage T4 tRNA
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
five additional secondary cleavage sites in RNA A3t from bacteriophage T7
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
HIV-1 RT displays the same cleavage specificity as RNase D
-
-
?
additional information
?
-
cleave internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
cleave internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
small hairpins based on the stem structures associated with the Aquifex 16S and 23S rRNA precursors are cleaved at sites that are consistent with production of the immediate precursors to the mature rRNAs. Substrate reactivity is independent of the distal box sequence, but is strongly dependent on the proximal box sequence. RNase III mechanism of dsRNA cleavage, overview
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
-
required for 3external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo
-
-
?
additional information
?
-
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
?
additional information
?
-
-
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
?
additional information
?
-
-
txpA and RatA form an extended hybrid that is a substrate for RNase III cleavage
-
-
?
additional information
?
-
-
Dicer functions as a dsRNA-processing enzyme, producing small interfering RNA (siRNA). Dicer plays important roles in RNA processing, posttranscriptional gene expression control, and defense against virus infection. Bacterial RNase III functions not only as a processing enzyme, but also as a binding protein that binds dsRNA without cleaving it
-
-
?
additional information
?
-
-
RNase III creates the substrate for PNPase that degrades the small RNA37, thus destroying the double-stranded 5' stem
-
-
?
additional information
?
-
cleavage of an artificial 23S rRNA stem-loop substrate by the wild-type enzyme. The sequence is composed of the double-stranded stem portion of the Borrelia burgdorferi 23S rRNA transcript with a loop of four unmatched nucleotides. Modelling for rRNA processing, overview
-
-
?
additional information
?
-
-
cleavage of an artificial 23S rRNA stem-loop substrate by the wild-type enzyme. The sequence is composed of the double-stranded stem portion of the Borrelia burgdorferi 23S rRNA transcript with a loop of four unmatched nucleotides. Modelling for rRNA processing, overview
-
-
?
additional information
?
-
-
analysis of the ability of different metal ions and substrates to support the activity of RNase III in vitro, overview. Brucella melitensis sRNA and Homo sapiens pre-miRNAs as substrates: BM-pri-0015, BM-pre-0015, Has-let-7a-1, and Has-mir-16-1, transcripted by standard T7 transcription kit with [alpha-32P]-UTP labeling. BM-pri-0015 is 300 nt in length, while BM-pre-0015, Has-let-7a-1, and Has-mir-16-1 are about 70 nt. All the transcript sequences are featured with stem-loop structures. Bm-RNase III can not only bind prokaryotic sRNA, but also bind eukaryotic pre-miRNAs
-
-
?
additional information
?
-
-
analysis of the ability of different metal ions and substrates to support the activity of RNase III in vitro, overview. Brucella melitensis sRNA and Homo sapiens pre-miRNAs as substrates: BM-pri-0015, BM-pre-0015, Has-let-7a-1, and Has-mir-16-1, transcripted by standard T7 transcription kit with [alpha-32P]-UTP labeling. BM-pri-0015 is 300 nt in length, while BM-pre-0015, Has-let-7a-1, and Has-mir-16-1 are about 70 nt. All the transcript sequences are featured with stem-loop structures. Bm-RNase III can not only bind prokaryotic sRNA, but also bind eukaryotic pre-miRNAs
-
-
?
additional information
?
-
-
enzyme is essential, and is involved in RNA interference, i.e. RNAi, a post-transcriptional gene-silencing phenomenon, and germ line development
-
-
?
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
Dicer-1 and Dicer-2 show different substrate specificity in vivo: Dicer-2 generates small interfering RNAs, siRNAs, from long double-stranded RNA, dsRNA, whereas Dicer-1 produces microRNAs, miRNAs, from pre-miRNA. Dicer-2 can efficiently cleave pre-miRNA in vitro, but phosphate and the Dicer-2 partner protein R2D2 inhibit pre-miRNA cleavage in vivo. Wild-type Dicer-2, but not a mutant defective in ATP hydrolysis, can generate siRNAs faster than it can dissociate from a long dsRNA substrate. Dicer-1 does not efficiently process long dsRNA
-
-
?
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA inmammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as amechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
?
additional information
?
-
-
involved in the maturation of the ribosomal RNA precursor, and bacteriophage T7 mRNA precursors, enzyme participates in the degradation as well as maturation of diverse cellular, phage, and plasmid RNAs
-
-
?
additional information
?
-
-
no activity with (rA)25, (rU)25, (rC)25, dsDNA, ssDNA and an RNA-DNA hybrid
-
-
?
additional information
?
-
-
RNA structure-dependent uncoupling of substrate recognition and cleavage, in vitro selection and structure determination of cleavage resistant variants of T7 R1.1 RNA classes I and II, due to altered conformation, overview
-
-
?
additional information
?
-
-
specificity for A-form dsRNA, enzyme is loosely associated with ribosomes
-
-
?
additional information
?
-
-
substrate specificity of the recombinant hybrid enzyme mutants, substrate specificity is determined by the catalytic N-terminus of the enzyme
-
-
?
additional information
?
-
-
substrate specificity with diverse RNA mutant substrate variants, the RNA internal loop, in which is located the required single scissile phosphodiester, is the reactivity epitope the substrates, overview
-
-
?
additional information
?
-
as a binding protein, RNase III binds and stabilizes certain RNAs, thus suppressing the expression of certain genes
-
-
?
additional information
?
-
-
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
substrate is bdm mRNA with recombinant His-tagged RNase III. Introduction of random mutations at the RNase III cleavages sites in bdm mRNA alter the enzyme activity, secondary structures and the stability of hairpins containing the RNase III cleavage sites 3 and 4-II, and RNase II cleavage patterns, overview
-
-
?
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
?
additional information
?
-
-
RNase III specifically processes the proU mRNA within a conserved secondary structure extending from position +203 to +293 of the transcript
-
-
?
additional information
?
-
-
the enzyme cleaves the proU operon transcript reducing its half-life from 65 sec to 4 sec, the rapid degradation ensures efficient inhibition of proU expression and further uptake of osmoprotectants. Processing of dsRNA, product release is the rate-limiting step in the catalytic pathway
-
-
?
additional information
?
-
-
the enzyme processes betT and proU mRNA
-
-
?
additional information
?
-
-
the enzyme processes ribosomal RNA
-
-
?
additional information
?
-
-
the enzyme cleaves betT and proU mRNA. Introdution of nucleotide substitutions C33U and C39U in thhe enzymes' cleavage sites of betT mRNA inhibit the enzyme activity
-
-
?
additional information
?
-
the enzyme is active with DAPI-enriched pre-rRNA fragments
-
-
?
additional information
?
-
identification of the cleavage targets of the endonucleolytic enzyme at a transcriptome-wide scale and delineation of its in vivo cleavage rules, overview. Usage of tailored RNA-seq-based technology, which allows transcriptome-wide mapping of RNase III cleavage sites at a nucleotide resolution establishing a cleavage pattern of a double cleavage in an intra-molecular stem structure, leaving 2-nt-long 3' overhangs, and refines the base-pairing preferences in the cleavage site vicinity. The two stem positions between the cleavage sites are highly base-paired, usually involving at least one G-C or C-G base pair. A clear distinction between intra-molecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
-
-
?
additional information
?
-
bdm, corA, mltD, proU, betT, and proP mRNAs are used as RNase III substrates, cleavage site determination reveals that no distinct consensus sequences, which would account for the specificity of RNase III recognition and cleavage process, are observed when in vivo RNase III substrates are analyzed
-
-
?
additional information
?
-
-
bdm, corA, mltD, proU, betT, and proP mRNAs are used as RNase III substrates, cleavage site determination reveals that no distinct consensus sequences, which would account for the specificity of RNase III recognition and cleavage process, are observed when in vivo RNase III substrates are analyzed
-
-
?
additional information
?
-
identification of RNase III cleavage sites and generation of a map of the cleavage sites in both intra-molecular and intermolecular duplex substrates. The recognition of DC targets by RNase III is highly specific
-
-
?
additional information
?
-
predicted secondary structure of substrates' RNase III sites, overview
-
-
?
additional information
?
-
ribonuclease III site-specifically cleaves double-stranded(ds) structures in diverse cellular, plasmid and phage RNAs. The catalytic sites employ Mg2+ ions to hydrolyze phosphodiesters, providing products with two-nucleotide, 3'-overhangs and 5'-phosphomonoester, 3'-hydroxyl termini
-
-
?
additional information
?
-
-
ribonuclease III site-specifically cleaves double-stranded(ds) structures in diverse cellular, plasmid and phage RNAs. The catalytic sites employ Mg2+ ions to hydrolyze phosphodiesters, providing products with two-nucleotide, 3'-overhangs and 5'-phosphomonoester, 3'-hydroxyl termini
-
-
?
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
?
additional information
?
-
identification of the cleavage targets of the endonucleolytic enzyme at a transcriptome-wide scale and delineation of its in vivo cleavage rules, overview. Usage of tailored RNA-seq-based technology, which allows transcriptome-wide mapping of RNase III cleavage sites at a nucleotide resolution establishing a cleavage pattern of a double cleavage in an intra-molecular stem structure, leaving 2-nt-long 3' overhangs, and refines the base-pairing preferences in the cleavage site vicinity. The two stem positions between the cleavage sites are highly base-paired, usually involving at least one G-C or C-G base pair. A clear distinction between intra-molecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
-
-
?
additional information
?
-
identification of RNase III cleavage sites and generation of a map of the cleavage sites in both intra-molecular and intermolecular duplex substrates. The recognition of DC targets by RNase III is highly specific
-
-
?
additional information
?
-
-
the enzyme processes betT and proU mRNA
-
-
?
additional information
?
-
-
the enzyme cleaves betT and proU mRNA. Introdution of nucleotide substitutions C33U and C39U in thhe enzymes' cleavage sites of betT mRNA inhibit the enzyme activity
-
-
?
additional information
?
-
predicted secondary structure of substrates' RNase III sites, overview
-
-
?
additional information
?
-
processing of dsRNA, the PAZ domain specifically recognizes the 2-nt, 3'-overhangs of a processed dsRNA terminus
-
-
?
additional information
?
-
Dicer substrate recognition and specificity, overview
-
-
?
additional information
?
-
-
substrate is dsRNA specific to the HvAV-3e Bro11 and GFP genes. For small RNA cleavage, siRNA duplexes 21 nucleotides in length is used. The sequences of the oligonucleotides are the siRNA duplex-25 GUCCGGAUACUCUUUGCGGAC and siRNA duplex-11 GGAGGAAGAAAGGAGAAAGGA
-
-
?
additional information
?
-
-
ability of Dicer C-terminus to interact with 5-lipoxygenase
-
-
?
additional information
?
-
two-step cleavage of hairpin RNA with 5' overhangs
-
-
?
additional information
?
-
-
two-step cleavage of hairpin RNA with 5' overhangs
-
-
?
additional information
?
-
recombinant DICER protein processes a hairpin RNA with 5' overhangs in vitro and generates an intermediate duplex with a 29 nt-5' strand and a 23 nt-3' strand. Longer 5' overhangs with stable stem structures can reduce the efficiency or rate of substrate cleavage. In vitro two-step processing of the 5'-end labelled pre-mmu-mir-1982 RNA by recombinant DICER protein, overview
-
-
?
additional information
?
-
-
recombinant DICER protein processes a hairpin RNA with 5' overhangs in vitro and generates an intermediate duplex with a 29 nt-5' strand and a 23 nt-3' strand. Longer 5' overhangs with stable stem structures can reduce the efficiency or rate of substrate cleavage. In vitro two-step processing of the 5'-end labelled pre-mmu-mir-1982 RNA by recombinant DICER protein, overview
-
-
?
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA in mammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as a mechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
?
additional information
?
-
-
processing of dsRNA. Drosha acts on primary transcripts synthesized by RNA polymerase II that typically contain several miRNAs. Site-specific cleavage within irregular, extended hairpin structures (pri-miRNAs) creates the pre-miRNAs that then are delivered by Exportin5 to the cytoplasm for final maturation by Dicer. Drosha functions within a complex termed the microprocessor that contains a protein, DGCR8, that is required for Drosha action
-
-
?
additional information
?
-
-
the enzyme interacts with membrane lipids
-
-
?
additional information
?
-
-
Drosha cleavage site analysis, reactivity determinants of a pri-miRNA substrate for Drosha, and a proposed DGCR8-dsRNA interaction, and Dicer substrate recognition and specificity, overview
-
-
?
additional information
?
-
-
enzyme assay with commercial yeast tRNA
-
-
?
additional information
?
-
Dicer protein binds to target RNA through an asRNA and induces the cleavage of target RNA
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
the recombinant RNase III from Bacillus Calmette Guerin (BCG-RNase III) cleaves small hairpin RNA based on the conserved stem structure associated with Mycobacterium 16S ribosomal RNA precursor at specific sites, remnant endogenous ribonucleases from the expression host have no effect on cleavage assays. BCG-16S [hp] RNA is synthesized using 2.5 U/ml T7 RNA polymerase at 42°C for 4 h. The specific activity of the alpha-32P-UTP in the transcription reactions is 200 Ci/mol
-
-
?
additional information
?
-
Mycobacterium tuberculosis variant bovis Pasteur 1173P2
the recombinant RNase III from Bacillus Calmette Guerin (BCG-RNase III) cleaves small hairpin RNA based on the conserved stem structure associated with Mycobacterium 16S ribosomal RNA precursor at specific sites, remnant endogenous ribonucleases from the expression host have no effect on cleavage assays. BCG-16S [hp] RNA is synthesized using 2.5 U/ml T7 RNA polymerase at 42°C for 4 h. The specific activity of the alpha-32P-UTP in the transcription reactions is 200 Ci/mol
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
phylogenetic analysis, enzyme might be important for virus replication
-
-
?
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
substrate cleavage specificity
-
-
?
additional information
?
-
-
substrate specificity of the recombinant hybrid enzyme mutants, substrate specificity is determined by the catalytic N-terminus of the enzyme
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is involved in RNA processing and RNA interference, i.e. RNAi, regulation by a combination of primary and tertiary structural elements allowing a substrate-specific binding and cleavage efficiency
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
substrate specificity, overview, RNA substrate with introduced sequences stabilizing the RNA helix enhances binding while the turnover rate is reduced, thus substrate binding becomes rate-limiting
-
-
?
additional information
?
-
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
?
additional information
?
-
-
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
?
additional information
?
-
-
specificity of cleavage by Rnt1p relies on the presence of RNA tetraloop structures with the consensus sequence AGNN at the top of the target dsRNA. Identification of exocyclic groups of purines in the major groove downstream of the tetraloop as a major antideterminant in RNase III activity
-
-
?
additional information
?
-
design of series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate is engineered to carry a single or multiple 2'-O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Introduction of 2'-O-methyl ribonucleotides near the cleavage site increases the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'-O-methyl ribonucleotides inhibits cleavage while single 2'-fluoro ribonucleotide substitutions does not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated
-
-
?
additional information
?
-
-
design of series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate is engineered to carry a single or multiple 2'-O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Introduction of 2'-O-methyl ribonucleotides near the cleavage site increases the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'-O-methyl ribonucleotides inhibits cleavage while single 2'-fluoro ribonucleotide substitutions does not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated
-
-
?
additional information
?
-
-
Rnt1p, the major RNase III in Saccharomyces cerevisiae, cleaves RNA substrates containing hairpins capped by A/uGNN tetraloops, using its double-stranded RNA binding domains, dsRBD, to recognize a conserved tetraloop fold. The dsRBD adopts the same conformation in both the AAGU and AGAA complexes
-
-
?
additional information
?
-
-
the AAGU hairpin binds to and is efficiently cleaved by Rnt1p in the context of the snR47 stem sequence
-
-
?
additional information
?
-
-
processing of dsRNA, specific bp sequence elements can modulate substrate reactivity, and a network of hydrogen bonds provides an energetically important contribution to Rnt1p binding, a phylogenetic-based substrate alignment analysis reveals a statistically significant exclusion of the UA bp from the position adjacent to the tetraloop. Rnt1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways. The enzyme also interacts with Gar1p, a protein involved in pseudouridylation reactions, via its C-terminal portion adjacent to the dsRBD
-
-
?
additional information
?
-
-
the enzyme processes ribosomal RNA, small nucleolar RNA, small nuclear RNA, and messenger RNA
-
-
?
additional information
?
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
?
additional information
?
-
-
mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
?
additional information
?
-
the catalytic efficiency of yeast ribonuclease III depends on substrate specific product release rate. Development of a real-time FRET assay for the detection of dsRNA degradation by yeast RNase III (Rnt1p) and detection of kinetic bottlenecks controlling the reactivity of different substrates. Rnt1p cleavage reaction is not only limited by the rate of catalysis but can also depend on base-pairing of product termini. Cleavage products terminating with paired nucleotides, like the degradation signals found in coding mRNA sequence, were less reactive and more prone to inhibition than products having unpaired nucleotides found in noncoding RNA substrates
-
-
?
additional information
?
-
-
the catalytic efficiency of yeast ribonuclease III depends on substrate specific product release rate. Development of a real-time FRET assay for the detection of dsRNA degradation by yeast RNase III (Rnt1p) and detection of kinetic bottlenecks controlling the reactivity of different substrates. Rnt1p cleavage reaction is not only limited by the rate of catalysis but can also depend on base-pairing of product termini. Cleavage products terminating with paired nucleotides, like the degradation signals found in coding mRNA sequence, were less reactive and more prone to inhibition than products having unpaired nucleotides found in noncoding RNA substrates
-
-
?
additional information
?
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
?
additional information
?
-
the catalytic efficiency of yeast ribonuclease III depends on substrate specific product release rate. Development of a real-time FRET assay for the detection of dsRNA degradation by yeast RNase III (Rnt1p) and detection of kinetic bottlenecks controlling the reactivity of different substrates. Rnt1p cleavage reaction is not only limited by the rate of catalysis but can also depend on base-pairing of product termini. Cleavage products terminating with paired nucleotides, like the degradation signals found in coding mRNA sequence, were less reactive and more prone to inhibition than products having unpaired nucleotides found in noncoding RNA substrates
-
-
?
additional information
?
-
-
in vitro RNase III is active with MicA when it is in complex with its targets, ompA or lamB mRNAs. MicA is cleaved by RNase III in a coupled way with ompA mRNA
-
-
?
additional information
?
-
-
RNase III cleaves dsRNA
-
-
?
additional information
?
-
-
processing of dsRNA. Pac1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways
-
-
?
additional information
?
-
enzyme SmRNase III is double-strand specific and exhibits different preference for endogenous RNA substrates
-
-
?
additional information
?
-
-
enzyme SmRNase III is double-strand specific and exhibits different preference for endogenous RNA substrates
-
-
?
additional information
?
-
-
RNAIII and the endoribonuclease III coordinately regulate spa gene expression
-
-
?
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
?
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
?
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
?
additional information
?
-
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
Streptococcus pyogenes serotype 14
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
Streptococcus pyogenes serotype 14 HSC5
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
development of a method, called identification of specific cleavage position (ISCP), which enables the identification of direct endoribonuclease targets in vivo by comparing the 5' and 3' ends of processed transcripts between wild-type and RNase-deficient strains. The double-stranded specific RNase III in the human pathogen Streptococcus pyogenes is used as a model. Mapping of 92 specific cleavage positions (SCPs) among which, 48 are previously described and 44 are new, with the characteristic 2 nucleotides 3' overhang of RNase III. Most SCPs are located in untranslated regions of RNAs. Screening for RNase III targets using transcriptomic differential expression analysis (DEA) and comparison with the RNase III targets identified using the ISCP method. Method evaluation, overview. pre-rRNA maturation by RNase III
-
-
?
additional information
?
-
Streptococcus pyogenes serotype M1 SF370 (M1GAS)
development of a method, called identification of specific cleavage position (ISCP), which enables the identification of direct endoribonuclease targets in vivo by comparing the 5' and 3' ends of processed transcripts between wild-type and RNase-deficient strains. The double-stranded specific RNase III in the human pathogen Streptococcus pyogenes is used as a model. Mapping of 92 specific cleavage positions (SCPs) among which, 48 are previously described and 44 are new, with the characteristic 2 nucleotides 3' overhang of RNase III. Most SCPs are located in untranslated regions of RNAs. Screening for RNase III targets using transcriptomic differential expression analysis (DEA) and comparison with the RNase III targets identified using the ISCP method. Method evaluation, overview. pre-rRNA maturation by RNase III
-
-
?
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
?
additional information
?
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
Streptomyces coelicolor absB gene encodes an RNase III family endoribonuclease and is essential for antibiotic biosynthesis. AbsB controls its own expression by sequentially and site specifically cleaving stem-loop segments of its polycistronic transcript
-
-
?
additional information
?
-
-
the gene encoding RNase III in Streptomyces coelicolor is transcribed during exponential phase and is required for antibiotic production and for proper sporulation
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
-
the class 1 enzyme binds and processes small dsRNA molecules, it can cleave long dsRNA molecules, synthetic small interfering RNAs (siRNAs), and plant- and virus-derived siRNAs extracted from sweet potato plants
-
-
?
additional information
?
-
-
the enzyme cleaves ds-siRNAs and microRNAs (miRNAs) with a regular A-form conformation, while asymmetrical bulges, extensive mismatches and 2'-O-methylation of ds-siRNA and miRNA interfer with processing, substrate specifiicty of the enzyme in processing small RNA duplexes, overview
-
-
?
additional information
?
-
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
substrate specificity with RNA duplex substrates, overview. The proximal box is a primary reactivity epitope for Tm-23S[hp] RNA. a CG or GC bp substitution at pb position 2 reduces the relative reactivity to 0.1 and 0.3, respectively, while a CG or GC substitution at pb position 4 provides a relative reactivity of 0.1 or 0.4, respectively. At pb position 3, only the AU bp substitution causes a significant drop in relative reactivity, while none of the bp substitutions at pb position 1 has a significant effect
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
-
endonuclease mRPN1 directly binds with TbRGG2 and exhibits a nuclease-resistant association with two more proteins, 4160 and 8170, it might modulate gRNA utilization by editing complexes
-
-
?
additional information
?
-
-
recombinant mRPN1 is a dimeric dsRNA-dependent endonuclease that generates 2-nucleotide 3' overhangs, cleavage specificity of mRPN1 is reminiscent of bacterial RNase III and thus is fundamentally distinct from editing endonucleases, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
25S pre-rRNA + H2O
25S rRNA
-
processing
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
ds-rRNA + H2O
mature ds-rRNA
dsRNA + H2O
?
-
cleavage to short RNA pieces
-
-
?
dsRNA + H2O
processed RNA
-
-
-
-
?
mraZ mRNA + H2O
?
the degradation of mraZ mRNA is performed by RNase III and the 3'-to-5' exoribonuclease, PNPase. The cleavage site for mraZ mRNA by RNase III is in the coding region
-
-
?
pre-16S rRNA + H2O
mature 16S rRNA
-
-
-
-
?
pre-23S rRNA + H2O
mature 23S rRNA
-
-
-
-
?
pre-5S rRNA + H2O
mature 5S rRNA
-
-
-
-
?
pre-mRNA + H2O
mature mRNA
-
enzyme regulates gene expression by controlling mRNA translation and stability
-
-
?
pre-rRNA + H2O
mature rRNA
pre-snoRNA + H2O
mature snoRNA
pre-snRNA + H2O
mature snRNA
additional information
?
-
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for processing of dsRNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
responsible for processing and maturation of RNA precursors into functional rRNA, mRNA and other small RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
134334, 134335, 134336, 134337, 134338, 134339, 134340, 134341, 134342, 134343, 134345, 134346, 134348, 134349, 134351, 134352, 134353, 134354, 134357, 134358, 134359, 134360, 134361, 134362, 134364, 134365 -
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
involved in the production of short interfering RNAs (siRNAs) and for the processing of precursor miRNAs (pre-miRNAs) into microRNAs (miRNAs)
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for the production of short interfering RNAs and microRNAs that induce gene silencing known as RNA interference
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
the enzyme is able to process rRNAs and to regulate the levels of polynucleotide phosphorylase
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
processing of precursor dsRNAs into mature microRNAs and small-interfering RNAs
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, preferred substrate contains NGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
enzyme plays multiple roles in the processing of rRNA and mRNA and strongly affects the decay of the sRNA MicA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
dsRNA-specific endonuclease activity enhances the RNA-silencing suppression activity of another protein (p22) encoded by SPCSV. RNase3 and p22 coexpression reduce siRNA accumulation more efficiently than p22 alone in Nicotiana benthamiana leaves expressing a strong silencing inducer (i.e., dsRNA). RNase3 does not cause intracellular silencing suppression or reduce accumulation of siRNA in the absence of p22 or enhance silencing suppression activity of a protein encoded by a heterologous virus
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
ds-rRNA + H2O
mature ds-rRNA
-
-
-
-
?
ds-rRNA + H2O
mature ds-rRNA
-
-
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors in to mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
enzyme is involved in the maturation and decay of cellular, phage and plasmid RNAs
-
-
?
dsRNA + H2O
mature RNA
-
enzyme plays a key role in diverse maturation and degradation processes
-
-
?
dsRNA + H2O
mature RNA
-
obligatory step in the maturation and decay of diverse RNAs
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
enzyme is required for processing
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
-
-
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
enzyme is required for processing
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
enzyme is required for processing
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA
-
-
?
additional information
?
-
-
small hairpins based on the stem structures associated with the Aquifex 16S and 23S rRNA precursors are cleaved at sites that are consistent with production of the immediate precursors to the mature rRNAs. Substrate reactivity is independent of the distal box sequence, but is strongly dependent on the proximal box sequence. RNase III mechanism of dsRNA cleavage, overview
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
-
required for 3external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo
-
-
?
additional information
?
-
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
?
additional information
?
-
-
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
?
additional information
?
-
-
Dicer functions as a dsRNA-processing enzyme, producing small interfering RNA (siRNA). Dicer plays important roles in RNA processing, posttranscriptional gene expression control, and defense against virus infection. Bacterial RNase III functions not only as a processing enzyme, but also as a binding protein that binds dsRNA without cleaving it
-
-
?
additional information
?
-
-
enzyme is essential, and is involved in RNA interference, i.e. RNAi, a post-transcriptional gene-silencing phenomenon, and germ line development
-
-
?
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
Dicer-1 and Dicer-2 show different substrate specificity in vivo: Dicer-2 generates small interfering RNAs, siRNAs, from long double-stranded RNA, dsRNA, whereas Dicer-1 produces microRNAs, miRNAs, from pre-miRNA. Dicer-2 can efficiently cleave pre-miRNA in vitro, but phosphate and the Dicer-2 partner protein R2D2 inhibit pre-miRNA cleavage in vivo. Wild-type Dicer-2, but not a mutant defective in ATP hydrolysis, can generate siRNAs faster than it can dissociate from a long dsRNA substrate. Dicer-1 does not efficiently process long dsRNA
-
-
?
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA inmammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as amechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
?
additional information
?
-
-
involved in the maturation of the ribosomal RNA precursor, and bacteriophage T7 mRNA precursors, enzyme participates in the degradation as well as maturation of diverse cellular, phage, and plasmid RNAs
-
-
?
additional information
?
-
as a binding protein, RNase III binds and stabilizes certain RNAs, thus suppressing the expression of certain genes
-
-
?
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
?
additional information
?
-
-
RNase III specifically processes the proU mRNA within a conserved secondary structure extending from position +203 to +293 of the transcript
-
-
?
additional information
?
-
-
the enzyme cleaves the proU operon transcript reducing its half-life from 65 sec to 4 sec, the rapid degradation ensures efficient inhibition of proU expression and further uptake of osmoprotectants. Processing of dsRNA, product release is the rate-limiting step in the catalytic pathway
-
-
?
additional information
?
-
-
the enzyme processes betT and proU mRNA
-
-
?
additional information
?
-
-
the enzyme processes ribosomal RNA
-
-
?
additional information
?
-
identification of the cleavage targets of the endonucleolytic enzyme at a transcriptome-wide scale and delineation of its in vivo cleavage rules, overview. Usage of tailored RNA-seq-based technology, which allows transcriptome-wide mapping of RNase III cleavage sites at a nucleotide resolution establishing a cleavage pattern of a double cleavage in an intra-molecular stem structure, leaving 2-nt-long 3' overhangs, and refines the base-pairing preferences in the cleavage site vicinity. The two stem positions between the cleavage sites are highly base-paired, usually involving at least one G-C or C-G base pair. A clear distinction between intra-molecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
-
-
?
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
?
additional information
?
-
identification of the cleavage targets of the endonucleolytic enzyme at a transcriptome-wide scale and delineation of its in vivo cleavage rules, overview. Usage of tailored RNA-seq-based technology, which allows transcriptome-wide mapping of RNase III cleavage sites at a nucleotide resolution establishing a cleavage pattern of a double cleavage in an intra-molecular stem structure, leaving 2-nt-long 3' overhangs, and refines the base-pairing preferences in the cleavage site vicinity. The two stem positions between the cleavage sites are highly base-paired, usually involving at least one G-C or C-G base pair. A clear distinction between intra-molecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
-
-
?
additional information
?
-
-
the enzyme processes betT and proU mRNA
-
-
?
additional information
?
-
processing of dsRNA, the PAZ domain specifically recognizes the 2-nt, 3'-overhangs of a processed dsRNA terminus
-
-
?
additional information
?
-
-
ability of Dicer C-terminus to interact with 5-lipoxygenase
-
-
?
additional information
?
-
two-step cleavage of hairpin RNA with 5' overhangs
-
-
?
additional information
?
-
-
two-step cleavage of hairpin RNA with 5' overhangs
-
-
?
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA in mammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as a mechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
?
additional information
?
-
-
processing of dsRNA. Drosha acts on primary transcripts synthesized by RNA polymerase II that typically contain several miRNAs. Site-specific cleavage within irregular, extended hairpin structures (pri-miRNAs) creates the pre-miRNAs that then are delivered by Exportin5 to the cytoplasm for final maturation by Dicer. Drosha functions within a complex termed the microprocessor that contains a protein, DGCR8, that is required for Drosha action
-
-
?
additional information
?
-
-
the enzyme interacts with membrane lipids
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
phylogenetic analysis, enzyme might be important for virus replication
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is involved in RNA processing and RNA interference, i.e. RNAi, regulation by a combination of primary and tertiary structural elements allowing a substrate-specific binding and cleavage efficiency
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
?
additional information
?
-
-
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
?
additional information
?
-
-
Rnt1p, the major RNase III in Saccharomyces cerevisiae, cleaves RNA substrates containing hairpins capped by A/uGNN tetraloops, using its double-stranded RNA binding domains, dsRBD, to recognize a conserved tetraloop fold. The dsRBD adopts the same conformation in both the AAGU and AGAA complexes
-
-
?
additional information
?
-
-
processing of dsRNA, specific bp sequence elements can modulate substrate reactivity, and a network of hydrogen bonds provides an energetically important contribution to Rnt1p binding, a phylogenetic-based substrate alignment analysis reveals a statistically significant exclusion of the UA bp from the position adjacent to the tetraloop. Rnt1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways. The enzyme also interacts with Gar1p, a protein involved in pseudouridylation reactions, via its C-terminal portion adjacent to the dsRBD
-
-
?
additional information
?
-
-
the enzyme processes ribosomal RNA, small nucleolar RNA, small nuclear RNA, and messenger RNA
-
-
?
additional information
?
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
-
in vitro RNase III is active with MicA when it is in complex with its targets, ompA or lamB mRNAs. MicA is cleaved by RNase III in a coupled way with ompA mRNA
-
-
?
additional information
?
-
-
processing of dsRNA. Pac1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways
-
-
?
additional information
?
-
enzyme SmRNase III is double-strand specific and exhibits different preference for endogenous RNA substrates
-
-
?
additional information
?
-
-
enzyme SmRNase III is double-strand specific and exhibits different preference for endogenous RNA substrates
-
-
?
additional information
?
-
-
RNAIII and the endoribonuclease III coordinately regulate spa gene expression
-
-
?
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
?
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
?
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
?
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
?
additional information
?
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
Streptomyces coelicolor absB gene encodes an RNase III family endoribonuclease and is essential for antibiotic biosynthesis. AbsB controls its own expression by sequentially and site specifically cleaving stem-loop segments of its polycistronic transcript
-
-
?
additional information
?
-
-
the gene encoding RNase III in Streptomyces coelicolor is transcribed during exponential phase and is required for antibiotic production and for proper sporulation
-
-
?
additional information
?
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
-
the class 1 enzyme binds and processes small dsRNA molecules, it can cleave long dsRNA molecules, synthetic small interfering RNAs (siRNAs), and plant- and virus-derived siRNAs extracted from sweet potato plants
-
-
?
additional information
?
-
processing of dsRNA
-
-
?
additional information
?
-
-
endonuclease mRPN1 directly binds with TbRGG2 and exhibits a nuclease-resistant association with two more proteins, 4160 and 8170, it might modulate gRNA utilization by editing complexes
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
evolution
-
mRPN1 is a homologue of the REN endonucleases
evolution
-
Tm-RNase III cleaves an Ec-RNase III substrate with identical specificity and is inhibited by antideterminant bp that also inhibit Ec-RNase III, indicating the conservation, across a broad phylogenetic distance, of positive and negative determinants of reactivity of bacterial RNase III substrates
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as RNase III in Escherichia coli. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as Rnt1 in Saccharomyces cerevisiae. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as Rnt1 in Saccharomyces cerevisiae. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as Rnt1 in Saccharomyces cerevisiae. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as Rnt1 in Saccharomyces cerevisiae. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as Rnt1 in Saccharomyces cerevisiae. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as Rnt1 in Saccharomyces cerevisiae. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
-
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
-
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
-
the enzyme belongs to the the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
the enzyme is a member of the ribonuclease III (RNase III) family
evolution
the enzyme is a member of the ribonuclease III (RNase III) family
evolution
the enzyme is a member of the ribonuclease III (RNase III) family
evolution
-
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases
evolution
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases. Streptomyces coelicolor and Streptomyces antibioticus are not closely related species within the genus
evolution
-
the virus-encoded RNase3 binds dsRNA as a dimer, which is the active form able to accommodate dsRNA binding and cleavage, and supports the classification of RNase3 as a class 1 RNase III endoribonuclease
evolution
members of the ribonuclease (RNase) III family of enzymes are metal-dependent double-strand specific endoribonucleases. They are ubiquitously found and eukaryotic RNase III-like enzymes include Dicer and Drosha, involved in RNA processing and RNA interference. SmRNase III is a typical double-strand specific endoribonuclease, but with a minimal substrate length requirement different from that of its enterobacterial orthologue
evolution
RNase III is a member of the phylogenetically highly conserved endoribonuclease III family
evolution
RNase III is a member of the phylogenetically highly conserved endoribonuclease III family
evolution
-
the enzyme is a member of the RNase III superfamily
evolution
the two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes share 75% amino acid sequence identity
evolution
-
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases. Streptomyces coelicolor and Streptomyces antibioticus are not closely related species within the genus
-
evolution
-
the enzyme is a member of the ribonuclease III (RNase III) family
-
evolution
-
the enzyme is a member of the ribonuclease III (RNase III) family
-
evolution
-
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
-
evolution
-
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases
-
evolution
Mycobacterium tuberculosis variant bovis Pasteur 1173P2
-
the enzyme is a member of the ribonuclease III (RNase III) family
-
evolution
-
the enzyme is a member of the RNase III superfamily
-
malfunction
-
dicer conditional knock-out retinas show developmental changes at embryonic day 16. In the absence of dicer in the embryonic retina, production of early generated cell types (ganglion and horizontal cells) is increased, and markers of late progenitors are not expressed. This phenotype persists into postnatal retina, in which the dicer-deficient progenitors fail to generate late-born cell types such as rods and Müller glia but continue to generate ganglion cells. Increase in apoptosis in dicer-deficient retinas. Most dicer-deficient cells die by adulthood. Postnatal day 5 dicer conditional knock-out retinas show a similar phenotype as that found at postnatal day 1. Select micro-RNAs are lost from dicer conditional knock-out areas at embryonic day 16
malfunction
-
on silencing drosha, a critical effector of micro-RNA maturation, significant inhibition of normal development and hatching in short interfering (si)RNA-soaked eggs. Drosha knockdown proves embryonically lethal. Impact of silencing dicer substantial up-regulates dicer transcript abundance, which does not impact on egg differentiation or hatching rates. Soaking the J2s in dicer siRNA results in a modest decrease in dicer transcript abundance which has no observable impact on phenotype or behaviour within 48 h of initial exposure to siRNA
malfunction
-
inducible knockdown of mRPN1 in Trypanosoma brucei results in loss of gRNA and accumulation of precursor transcripts, consistent with a role of mRPN1 in processing
malfunction
-
the rnc RNase III mutant strain has reduced levels of one of the full-length GadY-dependent bands. However, this mutant does not abolish processing, indicating redundancy with respect to enzymes capable of catalyzing GadY-directed processing
malfunction
a gene disruption mutant strain does not produce full-length or truncated forms of RNase III and grows more vigorously than its parent on actinomycin production medium but produces significantly lower levels of actinomycin. Complementation of the rnc disruption with the wild-type rnc gene from Streptomyces antibioticus restores actinomycin production to nearly wild-type levels
malfunction
-
blocking of RNase III processing by mutation of the processing site eliminates post-transcriptional osmoregulation of proU
malfunction
-
Drosha knockdown, but not Dicer knockdown, in stromal cells leads to a partial stall in the G1 phase of the cell cycle. In the absence of regulation by Drosha, neurogenin 2, Ngn2, accumulates resulting in a loss of stem cell fidelity and ultimately neuronal degeneration, the phenotype is independent of miRNAs. Non-redundant phenotypes caused by Drosha or Dicer deficiency occur most commonly in progenitor populations as opposed to mature, differentiated cell types. Knockdown of either Drosha or Dicer in human cells permits aberrant DNA replication and cell division in DNAdamage-induced senescent cells
malfunction
-
Drosha knockdown, but not Dicer knockdown, in stromal cells led to a partial stall in the G1 phase of the cell cycle. In the absence of regulation by Drosha, neurogenin 2, Ngn2, accumulates resulting in a loss of stem cell fidelity and ultimately neuronal degeneration, the phenotype is independent of miRNAs. Non-redundant phenotypes caused by Drosha or Dicer deficiency occur most commonly in progenitor populations as opposed to mature, differentiated cell types
malfunction
-
enzyme-deficient CRC cells show a reduced number of alkaline phosphatase-positive reprogrammed cells than wild-type cells, phenotype analysis of enzyme-deficient mutant HCT116 and DLD-1 cancer cell lines, overview. Transfection of specific transcription factors, such as Oct4, Sox2, Klf4 and c-Myc, or of miR-302s results in a considerable modulation of the malignant phenotypes of cancer cells, i.e. invasion, cell growth, tumorigenicity, and sensitivity to chemotherapeutic reagents and differentiation reagents, such as vitamins
malfunction
gene rnc deletion mutants are slow in rRNA operon induction and synthetically lethal with gene fis, encoding the transcriptional regulator Fis. In the absence of RNase III, not only the double pre-rRNP length gradient is lost but also the relative RNA polymerase occupancy in the spacer and nonspacer regions are approximately similar
malfunction
-
in the absence of RNase III, only trace amounts of 30S rRNA precursor are observed in Bacillus subtilis. A significant increase in the steady-state levels of the type I toxin mRNA txpA occurs in strains depleted for RNase III. Expression of the txpA and yonT toxin mRNAs account for the lethality of the Skin and SPbeta prophages in RNase III mutants
malfunction
-
non-redundant phenotypes caused by Dicer deficiency occur most commonly in progenitor populations as opposed to mature, differentiated cell types
malfunction
-
non-redundant phenotypes caused by Dicer deficiency occur most commonly in progenitor populations as opposed to mature, differentiated cell types
malfunction
a chromosomal rncBb gene exhibits a pleiotropic phenotype, including decreased growth rate and increased cell length. RNase III mutant is viable but has altered processing of rRNA, phenotype, overview
malfunction
-
Bm-RNase III is differently expressed in Brucella virulence strain 027 and vaccine strain M5-90
malfunction
deletion of cgR_1596 causes a defect in cell separation, deletion mutant of gene cgR_1959 (DELTArnc mutant) shows an elongated cell shape, and presence of several lines on the cell surface, indicating a required of RNase III for maintaining normal cell morphology in Corynebacterium glutamicum, phenotype, overview. The level of mraZ mRNA is increased, whereas cgR_1596 mRNA encoding a putative cell wall hydrolase and ftsEX mRNA is decreased in the DELTArnc mutant. The half-life of mraZ mRNA is significantly prolonged in the DELTArnc and the DELTApnp mutant strains
malfunction
in enzyme mutants E44A and D48A, the bond between the residue E44 and Mg2+ is broken and the bond between the residue D48 and Mg2+ interrupted. The proper positioning of Mg2+ ion in catalytic centre fails because of these broken bonds. The enzyme is deactivated by preventing the formation of trigonal bipyramidal pentavalent phosphorane intermediate
malfunction
in Streptomyces pyogenes, under standard growth conditions, RNase III has a limited impact both on antisense transcripts and on global gene expression with the expression of most of the affected genes being downregulated in an RNase III deletion mutant
malfunction
pyruvate dehydrogenase activity is increased in an rnc deletion mutant compared to the wild-type strain in early stationary phase, confirming the link between RNA turnover and regulation of pathway activity
malfunction
SmRNase III loss-of-function neither compromises viability nor alters morphology of Sinorhizobium meliloti cells, but influences growth, nodulation kinetics, the onset of nitrogen fixation and the overall symbiotic efficiency of this bacterium on the roots of its legume host, alfalfa, which ultimately affects plant growth. Appearance of pink nodules. Symbiotic phenotype of the SmDELTArnc mutant
malfunction
the YmdB R40A mutation causes a 16fold increase in KD, and the D128A mutation in both RNase III subunits (D128A/D1280A) causes an 83fold increase in KD
malfunction
whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild-type. Imprecise maturation of 23S rRNA is observed in the rnc3/4 double mutant, suggesting that exoribonucleases generate staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype is found at the 3' end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3' extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant shows overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlates with that of the extended 4.5S rRNA precursor. Mature 23S rRNA 3' ends are unaffected by mini-RNase III deficiency
malfunction
while RNA interference (RNAi) knockdown of either KREPB9 or KREPB10 produces no growth defect in procyclic-form parasites, the extent of the knockdown is relatively weak, with only 29% of KREPB9 mRNA or 43% of KREPB10 mRNA eliminated in each cell line
malfunction
-
a gene disruption mutant strain does not produce full-length or truncated forms of RNase III and grows more vigorously than its parent on actinomycin production medium but produces significantly lower levels of actinomycin. Complementation of the rnc disruption with the wild-type rnc gene from Streptomyces antibioticus restores actinomycin production to nearly wild-type levels
-
malfunction
-
while RNA interference (RNAi) knockdown of either KREPB9 or KREPB10 produces no growth defect in procyclic-form parasites, the extent of the knockdown is relatively weak, with only 29% of KREPB9 mRNA or 43% of KREPB10 mRNA eliminated in each cell line
-
malfunction
Mycobacterium tuberculosis variant bovis Pasteur 1173P2
-
in enzyme mutants E44A and D48A, the bond between the residue E44 and Mg2+ is broken and the bond between the residue D48 and Mg2+ interrupted. The proper positioning of Mg2+ ion in catalytic centre fails because of these broken bonds. The enzyme is deactivated by preventing the formation of trigonal bipyramidal pentavalent phosphorane intermediate
-
malfunction
-
pyruvate dehydrogenase activity is increased in an rnc deletion mutant compared to the wild-type strain in early stationary phase, confirming the link between RNA turnover and regulation of pathway activity
-
malfunction
Streptococcus pyogenes serotype M1 SF370 (M1GAS)
-
in Streptomyces pyogenes, under standard growth conditions, RNase III has a limited impact both on antisense transcripts and on global gene expression with the expression of most of the affected genes being downregulated in an RNase III deletion mutant
-
malfunction
-
Bm-RNase III is differently expressed in Brucella virulence strain 027 and vaccine strain M5-90
-
metabolism
-
the enzymes that catalyze the final steps of rRNA maturation, RNase J1, Mini-III and RNase M5, function efficiently without prior RNase III action
metabolism
-
the RNase III-mediated regulatory pathway functions to modulate corA expression and, in turn, the influx of metal ions transported by CorA in Escherichia coli
metabolism
-
two tandem RNase III cleavage sites determine betT mRNA stability in response to osmotic stress. The betT gene forms part of the osmoregulatory system Bet regulon, which participates in the synthesis of glycine betaine from externally supplied choline. BetT protein belongs to the betaine-choline-carnitine transporter family. The enzyme affects also the choline-uptake proU transporter system
metabolism
editosomes are the multiprotein complexes that catalyze the insertion and deletion of uridines to create translatable mRNAs in the mitochondria of kinetoplastids. Recognition and cleavage of a broad diversity of RNA substrates in vivo require three functionally distinct RNase III-type endonucleases (that act at distinct sites), as well as five additional editosome proteins that contain noncatalytic RNase III domains. RNase III domains have been identified in the editosome accessory proteins KREPB9 and KREPB10, suggesting a role related to editing endonuclease function, although KREPB9 and KREPB10 are not essential in either bloodstream-form parasites or procyclic-form parasites. Editosome interactions with KREPB9 and KREPB10 are mediated by the noncatalytic RNase III domain, consistent with a role in endonuclease specialization in Trypanosoma brucei. KREPB9 and KREPB10 are essential for editosome association, potentially via dimerization with RNase III domains in other editosome proteins
metabolism
influence of different RNase activities, including RNase III, on central metabolism, overview
metabolism
RNase III activity during various environmental stresses, overview
metabolism
RNase III plays a key role in posttranscriptional regulatory pathways in Escherichia coli. RNase III-mediated regulation of environmental stress-related genes provide evidence of the critical role of RNase III in rapid cellular responses to various stress conditions. Although regulation of such genes by RNase III is essential for bacteria to adapt to a wide range of environmental conditions that they encounter in nature, the exact mode of substrate recognition and mechanisms underlying the regulation of RNase III activity is not fully understood, RNase III activity during various environmental stresses, overview. Mechanisms of RNase III-mediated regulation of a subgroup of mRNA species including bdm, betT, proP, and proU whose protein products are associated with the cellular response to osmotic stress
metabolism
the enzyme is involved in plastid rRNA maturation
metabolism
-
the RNase III-mediated regulatory pathway functions to modulate corA expression and, in turn, the influx of metal ions transported by CorA in Escherichia coli
-
metabolism
-
editosomes are the multiprotein complexes that catalyze the insertion and deletion of uridines to create translatable mRNAs in the mitochondria of kinetoplastids. Recognition and cleavage of a broad diversity of RNA substrates in vivo require three functionally distinct RNase III-type endonucleases (that act at distinct sites), as well as five additional editosome proteins that contain noncatalytic RNase III domains. RNase III domains have been identified in the editosome accessory proteins KREPB9 and KREPB10, suggesting a role related to editing endonuclease function, although KREPB9 and KREPB10 are not essential in either bloodstream-form parasites or procyclic-form parasites. Editosome interactions with KREPB9 and KREPB10 are mediated by the noncatalytic RNase III domain, consistent with a role in endonuclease specialization in Trypanosoma brucei. KREPB9 and KREPB10 are essential for editosome association, potentially via dimerization with RNase III domains in other editosome proteins
-
metabolism
-
influence of different RNase activities, including RNase III, on central metabolism, overview
-
metabolism
-
two tandem RNase III cleavage sites determine betT mRNA stability in response to osmotic stress. The betT gene forms part of the osmoregulatory system Bet regulon, which participates in the synthesis of glycine betaine from externally supplied choline. BetT protein belongs to the betaine-choline-carnitine transporter family. The enzyme affects also the choline-uptake proU transporter system
-
physiological function
-
dicer contains the PAZ domain. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
dicer is necessary for the developmental change in competence of the retinal progenitor cells
physiological function
-
drosha does not contain the PAZ domain while dicer does. Drosha is almost identical among vertebrates. RNase III domain A is very conserved in vertebrates. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
drosha does not contain the PAZ domain while dicer does. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
drosha does not contain the PAZ domain while dicer does. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
drosha does not contain the PAZ domain. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
base pairing of the GadY small RNA with the intergenic region of the gadX-gadW mRNA results in directed processing events within the region of complementarity. Multiple enzymes are involved in the GadYdirected cleavage including the double-strand RNA-specific endoribonuclease RNase III, mechanism of regulation, overview
physiological function
-
cleavage of double-stranded RNA by ribonuclease III is a conserved early step in bacterial rRNA maturation, mechanism of dsRNA cleavage by RNase III, overview
physiological function
DICER is an RNase III family endoribonuclease that processes precursor microRNAs and long double-stranded RNAs, generating microRNA duplexes and short interfering RNA duplexes with 20-23 nucleotides in length
physiological function
-
Dicer-2 is a dsRNA-stimulated ATPase that hydrolyzes ATP to ADP. Dicer-2 generates small interfering RNAs, siRNAs, from long double-stranded RNA, dsRNA
physiological function
-
HvAV-3e RNase III is essential for virus DNA replication and infection using RNA interference-mediated gene silencing. RNase III is essential for virus pathology and DNA replication
physiological function
-
recombinant mRPN1 is a dimeric dsRNA-dependent endonuclease that requires Mg2+, a critical catalytic carboxylate, and generates 2-nucleotide 3' overhangs. Minicircles in the mitochondrial genome encode hundreds of small guide RNAs, gRNAs, that partially anneal with unedited mRNAs and direct the extensive editing. Trypanosoma brucei gRNAs and mRNAs are transcribed as polycistronic precursors, which undergo processing preceding editing. The mitochondrial RNA precursor-processing endonuclease 1, mRPN1, is involved in gRNA biogenesis, overview
physiological function
-
ribonuclease III cleaves double-stranded structures in bacterial RNAs and participates in diverse RNA maturation and decay pathways, RNase III mechanism of dsRNA cleavage, overview
physiological function
-
Rnt1p, the major RNase III in Saccharomyces cerevisiae, cleaves RNA substrates containing hairpins capped by A/uGNN tetraloops, using its dsRBD to recognize a conserved tetraloop fold
physiological function
-
role of endoribonucleases III and E in Salmonella typhimurium sRNA MicA regulation, MicA is a trans-encoded small non-coding RNA, which downregulates porin-expression in stationaryphase. RNase III regulates MicA in a target-coupled way, while RNase E controls free MicA levels in the cell, mechanisms, overview. ompA expression is regulated by RNase III and is dependent on MicA, and degradation of both the sRNA MicA and the ompA target mRNA is dependent on RNase III
physiological function
-
Staphylococcus aureus ribonuclease III belongs to the enzyme family known to degrade double-stranded RNAs. RNase III can regulate the pathogenicity of Staphylococcus aureus by influencing the level of extracellular proteins via two different ways respectively at different growth phases. During the lag phase of the bacterial growth cycle RNase III can influence the extracellular protein secretion via regulating the expression of secY2, one component of accessory secretory (sec) pathway. After Staphylococcus aureus cells grow to exponential phase, RNase III can regulate the expression of extracellular proteins by affecting the level of RNAIII
physiological function
-
the RNaseIII enzyme Drosha plays a pivotal role in microRNA, miRNA, biogenesis by cleaving primary miRNA transcripts to generate precursor miRNA in the nucleus. Nuclear localization of Drosha is critical for its functionality in miRNA processing
physiological function
-
tracrRNA directs the maturation of repeat/spacer-derived short crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein. The maturation of crRNAs represents a key event in CRISPR activation, all components are essential to protect Streptococcus pyogenes against prophage-derived DNA. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III or the related eukaryotic Dicer and Drosha enzymes
physiological function
-
enzyme RNase III cleavage at A and B sites of mltD mRNA regulates mltD degradation,
physiological function
-
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
-
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs. RNase III is negatively regulated by the macrodomain protein, YmdB, and might be dependent upon the direct interaction of the two proteins. The enzyme's catalytic activity is also subject to positive regulation. The T7 bacteriophage expresses a protein kinase that phosphorylates RNase III and enhances catalytic activity about fourfold, as measured in vitro
physiological function
-
the dsRNA-specific class 1 RNase III-like endoribonuclease encoded by sweet potato chlorotic stunt virus suppresses posttranscriptional gene silencing and eliminates antiviral defence in sweet potato plants in an endoribonuclease activity-dependent manner
physiological function
-
the enzyme has a broad function in gene regulation in response to stress and during host infection of Staphylococcus aureus. RNase III-mediated cleavage in the 5' untranslated region enhances the stability and translation of cspA mRNA, which encodes the major cold-shock protein. Processing of cspA mRNA by the enzyme activates CspA synthesis. RNase III cleaves overlapping 5'-UTRs of divergently transcribed genes to generate leaderless mRNAs, which constitutes a distinct way to co-regulate neighboring genes. RNase III initiates maturation of rRNA operons. In addition to gene regulation, the enzyme is associated with RNA quality control of pervasive transcription, complexity of post-transcriptional regulation mediated by RNase III, possible function of the enzyme in the decay of structured regions of mRNAs, overview
physiological function
-
the enzyme is a critical miRNA processing enzyme, miRNAs play crucial roles in developmental processes, stress response, stem cell physiology, and diseases such as cancer
physiological function
-
the enzyme is involved in RNA quality control. Processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
-
the enzyme is involved in RNA quality control. Processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
the enzyme is required for and regulates antibiotic production
physiological function
-
the enzyme negatively regulates the expression of betT, the cleavage determines betT mRNA stability in vivo, osmoregulation of betT expression by RNase III
physiological function
-
the enzyme plays a role in the mechanism of RatA mediated degradation of txpA mRNA both in vivo and in vitro and in cleaving double-stranded RNA in many biological systems, it is involved in ribosomal RNA maturation and mRNA turnover. In contrast to other bacteria, the enzyme is essential in Bacillus subtilis, it protects the organism from the expression of toxin genes borne by two prophages, through antisense RNA, although it is not responsible for the stabilities of antisense-RNAs. Degradation of type I toxin txpA is dependent on both RatA and RNase III. The organism uses RNase III or its homologues as part of viral defense or viral accommodation mechanisms
physiological function
the enzyme plays a role in the rapid induction of ribosomal operons during outgrowth and is essential in the absence of the transcriptional regulator Fis, suggesting a linkage of transcription and RNA processing for ribosomal operons in Escherichia coli, the enzyme has an effect on ribosome operon transcription and is involved in the early process steps of rRNA biogenesis, overview The enzyme is required for localization of the 5 pre-rRNA leader to the nucleoid and for optimal induction of rRNA synthesis. RNase III processing of pre-rRNA occurs cotranscriptionally
physiological function
-
the enzyme RNase III initiates rapid degradation of proU mRNA upon hypoosmotic stress, osmoregulation occurs at a post-transcriptional level. Upon osmotic downshift, the enzyme immediately processes the proU mRNA which reduces its half-life from 65 sec to less than 4 sec
physiological function
-
the human enzyme has multiple functions including ribonucleolytic, heparan sulfate binding, cellular binding, endocytic, lipid destabilization, cytotoxic, and antimicrobial activities
physiological function
-
the ribonuclease III enzyme Dicer has a central role in the biogenesis of microRNAs and small interfering RNAs. Dicer also acts in the biogenesis of DNA-damage-associated small RNAs, overview. Additionally, Dicer has critical roles in genome regulation and surveillance, including the production of endogenous small interfering RNAs from many sources, and the degradation of potentially harmful short interspersed element and viral RNAs
physiological function
-
the ribonuclease III enzyme Dicer has a central role in the biogenesis of microRNAs and small interfering RNAs. Dicer also acts in the biogenesis of DNA-damage-associated small RNAs, overview. Additionally, Dicer has critical roles in genome regulation and surveillance, including the production of endogenous small interfering RNAs from many sources, and the degradation of potentially harmful short interspersed element and viral RNAs
physiological function
-
the ribonuclease III enzymes Drosha and Dicer have central roles in the biogenesis of ribosomal RNA, microRNAs and small interfering RNAs, including p53, Lin28, DEAD-box RNA helicases and Smads. In neuronal progenitors, Drosha normally binds and cleaves stem-loop structures within the 3' UTR of proneuronal transcription factor neurogenin 2, Ngn2. Drosha also recognizes and cleaves messenger RNAs, and Drosha is necessary for the maturation of ribosomal RNA. mRNA cleavage occurs via recognition of secondary stem-loop structures similar to miRNA precursors, and is an important mechanism of repressing gene expression, particularly in progenitor/stem cell populations. Drosha-mediated rRNA processing is implicated in regulating cell cycle progression in human multi-potent stromal cells. Drosha and Dicer act in the biogenesis of DNA-damage-associated small RNAs, overview. Dicer also has critical roles in genome regulation and surveillance, including the production of endogenous small interfering RNAs from many sources, and the degradation of potentially harmful short interspersed element and viral RNAs
physiological function
-
the ribonuclease III enzymes Drosha and Dicer have central roles in the biogenesis of ribosomal RNA, microRNAs and small interfering RNAs, including p53, Lin28, DEAD-box RNA helicases and Smads. In neuronal progenitors, Drosha normally binds and cleaves stem-loop structures within the 3' UTR of proneuronal transcription factor neurogenin 2, Ngn2. Drosha also recognizes and cleaves messenger RNAs, and is necessary for the maturation of rRNA. mRNA cleavage occurs via recognition of secondary stem-loop structures similar to miRNA precursors, and is an important mechanism of repressing gene expression, particularly in progenitor/stem cell populations. Drosha and Dicer act in the biogenesis of DNA-damage-associated small RNAs, overview. Dicer also has critical roles in genome regulation and surveillance, including the production of endogenous small interfering RNAs from many sources, and the degradation of potentially harmful short interspersed element and viral RNAs
physiological function
-
the steady-state levels of metal transporter corA mRNA as well as the degree of cobalt influx into the cell are dependent on cellular concentrations of the enzyme RNase III. Enzyme RNase III cleavage constitutes a rate-determining step for corA mRNA degradation, downregulation of corA expression by the enzyme, overview. Introduction of point mutations in RNase III cleavage sites C-122G, U-153A, and A-152G of corA mRNA abolishes the enzyme cleavage activity on corA mRNA and results in prolonged half-lives of the mRNA
physiological function
-
bacterial ribonuclease III (RNase III) is a highly conserved endonuclease, which plays pivotal roles in RNA maturation and decay pathways by cleaving double-stranded structure of RNAs. Brucella melitensis RNase III can efficiently bind and cleave stem-loop structure of small RNA, and might participate in regulation of virulence in Brucella. Brucella melitensis BM-pri-0015 and BM-pre-0015 containing double strand RNA structure, and Homo sapiens pre-miRNAs Hsa-let-7a-1 and Hsa-mir-16-1 obtained from miRBase are substrates of Bm-RNase III
physiological function
bacterial RNase III plays important roles in the processing and degradation of RNA transcripts. A clear distinction between intramolecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
physiological function
endoribonuclease III (RNase III) is involved in processing the 23S rRNA in Borrelia burgdorferi. The enzyme is RNase III required for the full maturation of the 23S rRNA but not for the 5S rRNA nor for the 16S rRNA. Several ribonucleases, including RNase III, are involved in the production of ribosomes. RNase III is not essential in Borrelia burgdorferi
physiological function
importance of RNase III domain interactions to editosome architecture. Association of KREPB9 and KREPB10 with about 20S editosomes requires the RNase III structure
physiological function
in Streptomyces pyogenes, under standard growth conditions, RNase III has a limited impact both on antisense transcripts and on global gene expression with the expression of most of the affected genes being downregulated in an RNase III deletion mutant. pre-rRNA maturation by RNase III. RNase III has a limited impact on gene expression regulation
physiological function
members of the ribonuclease III (RNase III) family regulate gene expression by triggering the degradation of double stranded RNA (dsRNA)
physiological function
ribonuclease III (RNase III) is a conserved, gene-regulatory bacterial endonuclease that cleaves double-helical structures in diverse coding and noncoding RNAs. RNase III is subject to multiple levels of control, reflective of its global regulatory functions. Escherichia coli (Ec) RNase III catalytic activity is known to increase during bacteriophage T7 infection, reflecting the expression of the phage-encoded protein kinase, T7PK. Primary substrate for RNase III is the 5500 nt transcript of the rRNA operons, containing the 16S, 23S and 5S rRNAs, with the enzyme acting co-transcriptionally to provide the immediate precursors to the mature rRNAs8. RNase III also can determine mRNA half-life by catalyzing the rate-limiting cleavage step in the decay pathway. Double-helical structures that are formed by binding of small noncoding RNAs (sRNAs) provide RNase III targets, and regulate mRNA translation and/or stability. The diversity of RNase III targets and the multiple actions of the enzyme in conjunction with sRNAs and other factors underscore the global regulatory function of RNase III
physiological function
RNase III activity during various environmental stresses, overview
physiological function
RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at additional sites found in RNA of genes aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK, and gluQ accelerate RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three sites in the ahpF, pflB, and yajQ transcripts lead to stabilized secondary transcripts. Two other sites in hisL and pheM overlap with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the additional RNase III target sites are located on transcripts encoding metabolic enzymes, while two RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle
physiological function
RNase III mediated cleavage of the coding region of mraZ mRNA is required for efficient cell division in Corynebacterium glutamicum. MraZ is a transcriptional repressor of ftsEX in Corynebacterium glutamicum. Degradation of mraZ mRNA is performed by RNase III and the 3'-to-5' exoribonuclease, PNPase. Overproduction of MraZ results in an elongated cell shape. RNase III is required for efficient expression of MraZ-dependent ftsEX and MraZ-independent cgR_1596
physiological function
RNase III plays a role in rRNA and tRNA maturation in Escherichia coli. RNase III enzymatic activity can be regulated on multiple levels that include autoregulation by cleavage of its own mRNA message. The primary 30S rRNA transcript, which includes all of the rRNA genes, is cleaved by RNase III within the flanking double-stranded regions. This generates the 17S precursor of the 16S rRNA and the p23S precursor of the 23S rRNA. RNase III-mediated regulation of environmental stress-related genes provide evidence of the critical role of RNase III in rapid cellular responses to various stress conditions. Although regulation of such genes by RNase III is essential for bacteria to adapt to a wide range of environmental conditions that they encounter in nature, the exact mode of substrate recognition and mechanisms underlying the regulation of RNase III activity is not fully understood, RNase III activity during various environmental stresses, overview. Osmoregulation of RNase III activity, the osmoregulatory K+ uptake is mediated by the Trk and Kdp transporters. Analysis of substrate RNA molecules bound to RNase III by in vivo crosslinking and immunoprecipitation of RNase III indicated that downregulation of RNase III cleavage activity under hyperosmotic stress is caused by the decreased RNA binding capacity of RNase III. Autoregulation, Modulation of RNase III activity induced by antibiotic stress. RNase III can also be regulated by trans-acting factors, e.g. YmdB. T7 protein kinase positively regulates RNase III in Escherichia coli
physiological function
RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Arabidopsis thaliana chloroplast mini-ribonuclease III participates in rRNA maturation and intron recycling, overview. Key role of Mini-III in intron and noncoding RNA regulation
physiological function
SmRNase III degrades endogenous RNA substrates of diverse biogenesis with different efficiency, and is involved in the maturation of the 23S rRNA. Impact of SmRNase III on nodulation and symbiotic nitrogen fixation in plants. Enzyme SmRNase III influences free-living growth and symbiotic performance of Sinorhizobium meliloti on alfalfa roots
physiological function
the complex posttranscriptional regulation mechanism of the Escherichia coli pnp gene, which encodes the phosphorolytic exoribonuclease polynucleotide phosphorylase (PNPase), involves two endoribonucleases, namely, RNase III and RNase E, and PNPase itself, which thus autoregulates its own expression. Autogenous regulation of Escherichia coli PNPase via translational repression is RNase III-independent. The target of PNPase is a mature pnp mRNA previously processed at its 5' end by RNase III, rather than the primary pnp transcript (RNase III-dependent models). PNPase also regulates its own expression via a reversible RNase III-independent pathway acting upstream from the RNase III-dependent branch. This pathway requires the PNPase RNA binding domains KH and S1 but not its phosphorolytic activity. The RNase III-independent autoregulation of PNPase seem to occur at the level of translational repression, possibly by competition for pnp primary transcript between PNPase and the ribosomal protein S1
physiological function
-
the endoribonuclease RNase III cleaves double stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs, identification of transacting sRNAs that can be substrates of RNase III
physiological function
Streptococcus pyogenes serotype 14
-
the endoribonuclease RNase III cleaves double stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs, identification of transacting sRNAs that can be substrates of RNase III
physiological function
-
tracrRNA directs the maturation of repeat/spacer-derived short crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein. The maturation of crRNAs represents a key event in CRISPR activation, all components are essential to protect Streptococcus pyogenes against prophage-derived DNA. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III or the related eukaryotic Dicer and Drosha enzymes
-
physiological function
-
Staphylococcus aureus ribonuclease III belongs to the enzyme family known to degrade double-stranded RNAs. RNase III can regulate the pathogenicity of Staphylococcus aureus by influencing the level of extracellular proteins via two different ways respectively at different growth phases. During the lag phase of the bacterial growth cycle RNase III can influence the extracellular protein secretion via regulating the expression of secY2, one component of accessory secretory (sec) pathway. After Staphylococcus aureus cells grow to exponential phase, RNase III can regulate the expression of extracellular proteins by affecting the level of RNAIII
-
physiological function
-
the enzyme is required for and regulates antibiotic production
-
physiological function
-
enzyme RNase III cleavage at A and B sites of mltD mRNA regulates mltD degradation,
-
physiological function
-
members of the ribonuclease III (RNase III) family regulate gene expression by triggering the degradation of double stranded RNA (dsRNA)
-
physiological function
-
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
-
physiological function
-
the steady-state levels of metal transporter corA mRNA as well as the degree of cobalt influx into the cell are dependent on cellular concentrations of the enzyme RNase III. Enzyme RNase III cleavage constitutes a rate-determining step for corA mRNA degradation, downregulation of corA expression by the enzyme, overview. Introduction of point mutations in RNase III cleavage sites C-122G, U-153A, and A-152G of corA mRNA abolishes the enzyme cleavage activity on corA mRNA and results in prolonged half-lives of the mRNA
-
physiological function
-
bacterial RNase III plays important roles in the processing and degradation of RNA transcripts. A clear distinction between intramolecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
-
physiological function
-
importance of RNase III domain interactions to editosome architecture. Association of KREPB9 and KREPB10 with about 20S editosomes requires the RNase III structure
-
physiological function
-
the enzyme has a broad function in gene regulation in response to stress and during host infection of Staphylococcus aureus. RNase III-mediated cleavage in the 5' untranslated region enhances the stability and translation of cspA mRNA, which encodes the major cold-shock protein. Processing of cspA mRNA by the enzyme activates CspA synthesis. RNase III cleaves overlapping 5'-UTRs of divergently transcribed genes to generate leaderless mRNAs, which constitutes a distinct way to co-regulate neighboring genes. RNase III initiates maturation of rRNA operons. In addition to gene regulation, the enzyme is associated with RNA quality control of pervasive transcription, complexity of post-transcriptional regulation mediated by RNase III, possible function of the enzyme in the decay of structured regions of mRNAs, overview
-
physiological function
Streptococcus pyogenes serotype 14 HSC5
-
the endoribonuclease RNase III cleaves double stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs, identification of transacting sRNAs that can be substrates of RNase III
-
physiological function
-
the endoribonuclease RNase III cleaves double stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs, identification of transacting sRNAs that can be substrates of RNase III
-
physiological function
-
RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at additional sites found in RNA of genes aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK, and gluQ accelerate RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three sites in the ahpF, pflB, and yajQ transcripts lead to stabilized secondary transcripts. Two other sites in hisL and pheM overlap with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the additional RNase III target sites are located on transcripts encoding metabolic enzymes, while two RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle
-
physiological function
Streptococcus pyogenes serotype M1 SF370 (M1GAS)
-
in Streptomyces pyogenes, under standard growth conditions, RNase III has a limited impact both on antisense transcripts and on global gene expression with the expression of most of the affected genes being downregulated in an RNase III deletion mutant. pre-rRNA maturation by RNase III. RNase III has a limited impact on gene expression regulation
-
physiological function
-
bacterial ribonuclease III (RNase III) is a highly conserved endonuclease, which plays pivotal roles in RNA maturation and decay pathways by cleaving double-stranded structure of RNAs. Brucella melitensis RNase III can efficiently bind and cleave stem-loop structure of small RNA, and might participate in regulation of virulence in Brucella. Brucella melitensis BM-pri-0015 and BM-pre-0015 containing double strand RNA structure, and Homo sapiens pre-miRNAs Hsa-let-7a-1 and Hsa-mir-16-1 obtained from miRBase are substrates of Bm-RNase III
-
physiological function
-
the enzyme negatively regulates the expression of betT, the cleavage determines betT mRNA stability in vivo, osmoregulation of betT expression by RNase III
-
additional information
-
detection of MicA sense transcripts in an RNase III-deficient antisense mutant dependent on ompA
additional information
-
Dicer-2 contains C-terminal RNase III domains that mediate RNA cleavage
additional information
-
four conserved catalytic side-chains E214, D218, D288, and E291
additional information
-
orf27 encodes an RNase III-like protein after infection and demonstrates dsRNA specific endoribonuclease activity of the encoded protein. The Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing
additional information
-
Q157 is a conserved glutamine in the Aa-RNase III dsRNA-binding domain
additional information
-
structure of RNase III double-stranded RNA binding domain complex with a noncanonical RNA substrate, analysis of the binding specificity, overview. The dsRBD adopts the same conformation in both the AAGU and AGAA complexes. The AAGU tetraloop in the complex adopts a backbone fold similar to that of the AGAA tetraloop
additional information
-
the RNA binding and enzymatic domains of Drosha are located on its C-terminus, the N-terminus harbors a nuclear localization signal
additional information
-
features of the Rnt1p-substrate interaction contributing to processing reactivity, overview. Structure analysis and comparison to other enzyme family members, overview
additional information
-
structure analysis and comparison to other enzyme family members, overview
additional information
-
structure analysis and comparison to other enzyme family members, overview
additional information
structure analysis and comparison to other enzyme family members, overview
additional information
structure analysis and comparison to other enzyme family members, overview
additional information
structure analysis and comparison to other enzyme family members, overview
additional information
-
structure analysis and comparison to other enzyme family members, overview. Additional domains, including the dsRNA-binding and PAZ domains, that cooperate with the RNase III domain to select target sites, regulate activity, confer processivity, and support the recognition of structurally diverse substrates
additional information
structure analysis and comparison to other enzyme family members, overview. Additional domains, including the dsRNA-binding and PAZ domains, that cooperate with the RNase III domain to select target sites, regulate activity, confer processivity, and support the recognition of structurally diverse substrates
additional information
the dsRNA-binding domain and N-terminal domains of enzyme Rnt1p function as two rulers that measure the distance between the tetraloop and the cleavage site, mechanism, overview. Both rulers interact with the NGNN tetraloop: ruler 1 recognizes the Gua16 base, and ruler 2 secures the Gua16 recognition
additional information
-
the dsRNA-binding domain and N-terminal domains of enzyme Rnt1p function as two rulers that measure the distance between the tetraloop and the cleavage site, mechanism, overview. Both rulers interact with the NGNN tetraloop: ruler 1 recognizes the Gua16 base, and ruler 2 secures the Gua16 recognition
additional information
-
the enzyme autoregulates its own expression. Contributions of residues E135 and D63 to the active site of the enzyme
additional information
-
the enzyme binds siRNA as a dimer, which is the active form able to accommodate dsRNA binding and cleavage
additional information
-
three putative multifunctional heparin binding regions, 34RWRCK38 (HBR1), 75RSRFR79 (HBR2), and 101RPGRR105 (HBR3), of hRNase3 are identified by silico sequence analysis and validated by in vitro activity assays, the heparin binding peptide containing HBR1 is a key element associated with heparan sulfate binding, cellular binding, and lipid binding activities. Comparisons of CHO cell binding and cytotoxicity to Beas-2B cells of wild-type and mutant enzymes, overview
additional information
-
cleavage activity of Bm-RNase III is bivalent metal cations- and alkaline buffer-dependent. Glu133 is required for catalytic activity. Three-dimensional structural model of Bm-RNase III based on homology modeling, overview
additional information
complex formation of ribonuclease III with the regulatory macrodomain protein, YmdB, protein-protein docking and interaction analysis by homology modelling (using the Escherichia coli RNase III homodimer as template, PDB entry 1SPV, 2.0 A resolution) and surface plasmon resonance (SPR) analysis, kinetic and thermodynamic values for the YmdB-RNase III interaction, and the effect of specific mutations, overview. Interaction of the conserved YmdB residue R40 with specific RNase III residues at the subunit interface
additional information
-
complex formation of ribonuclease III with the regulatory macrodomain protein, YmdB, protein-protein docking and interaction analysis by homology modelling (using the Escherichia coli RNase III homodimer as template, PDB entry 1SPV, 2.0 A resolution) and surface plasmon resonance (SPR) analysis, kinetic and thermodynamic values for the YmdB-RNase III interaction, and the effect of specific mutations, overview. Interaction of the conserved YmdB residue R40 with specific RNase III residues at the subunit interface
additional information
crystallographic and modeling studies of RNase III from Aquifex aeolicus suggest that highly conserved six negatively charged residues, including E40/D44/D107/E110 and E37/E64, create two potential RNA cleavage sites within the catalytic valley
additional information
-
development of a custom script that can detect intergenic regions of the Streptococcus pyogenes genome. A differential expression analysis with Cufflinks and Stringtie identifies the intergenic regions whose expression is influenced by the RNase III gene deletion, identification of trans-acting sRNAs that can be substrates of RNase III. Analysis of sRNA degradation
additional information
Streptococcus pyogenes serotype 14
-
development of a custom script that can detect intergenic regions of the Streptococcus pyogenes genome. A differential expression analysis with Cufflinks and Stringtie identifies the intergenic regions whose expression is influenced by the RNase III gene deletion, identification of trans-acting sRNAs that can be substrates of RNase III. Analysis of sRNA degradation
additional information
Ec-RNase III homology-modeled structure in complex with cleaved dsRNA, overview
additional information
-
Ec-RNase III homology-modeled structure in complex with cleaved dsRNA, overview
additional information
members of ribonuclease III (RNase III) family recognize RNA motifs and cleave substrates at specific sites in a divalent-metal-ion-dependent manner. The residues E44 and D48 in BCG-RNase III are highly conserved and essential for catalytic activity
additional information
necessity of involvement of other transcripts for the binding of the double-strand-specific enzyme to the mRNAs is still unknown in the case of Streptomyces
additional information
probably a major role of the ultraconserved E125 amino acid in the metal-dependent catalysis mediated by enzyme SmRNase III
additional information
-
probably a major role of the ultraconserved E125 amino acid in the metal-dependent catalysis mediated by enzyme SmRNase III
additional information
-
necessity of involvement of other transcripts for the binding of the double-strand-specific enzyme to the mRNAs is still unknown in the case of Streptomyces
-
additional information
-
necessity of involvement of other transcripts for the binding of the double-strand-specific enzyme to the mRNAs is still unknown in the case of Streptomyces
-
additional information
-
the dsRNA-binding domain and N-terminal domains of enzyme Rnt1p function as two rulers that measure the distance between the tetraloop and the cleavage site, mechanism, overview. Both rulers interact with the NGNN tetraloop: ruler 1 recognizes the Gua16 base, and ruler 2 secures the Gua16 recognition
-
additional information
-
structure analysis and comparison to other enzyme family members, overview
-
additional information
-
the enzyme autoregulates its own expression. Contributions of residues E135 and D63 to the active site of the enzyme
-
additional information
Streptococcus pyogenes serotype 14 HSC5
-
development of a custom script that can detect intergenic regions of the Streptococcus pyogenes genome. A differential expression analysis with Cufflinks and Stringtie identifies the intergenic regions whose expression is influenced by the RNase III gene deletion, identification of trans-acting sRNAs that can be substrates of RNase III. Analysis of sRNA degradation
-
additional information
-
development of a custom script that can detect intergenic regions of the Streptococcus pyogenes genome. A differential expression analysis with Cufflinks and Stringtie identifies the intergenic regions whose expression is influenced by the RNase III gene deletion, identification of trans-acting sRNAs that can be substrates of RNase III. Analysis of sRNA degradation
-
additional information
Mycobacterium tuberculosis variant bovis Pasteur 1173P2
-
members of ribonuclease III (RNase III) family recognize RNA motifs and cleave substrates at specific sites in a divalent-metal-ion-dependent manner. The residues E44 and D48 in BCG-RNase III are highly conserved and essential for catalytic activity
-
additional information
-
necessity of involvement of other transcripts for the binding of the double-strand-specific enzyme to the mRNAs is still unknown in the case of Streptomyces
-
additional information
-
cleavage activity of Bm-RNase III is bivalent metal cations- and alkaline buffer-dependent. Glu133 is required for catalytic activity. Three-dimensional structural model of Bm-RNase III based on homology modeling, overview
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
E110A
uncoupling of the dsRNA-binding and processing abilities of the enzyme
Q157A
-
is a conserved glutamine in the Aa-RNase III dsRNA-binding domain. Aa-RNase III cleavage of the pre-16S substrate is blocked by the Q157A mutation, which reflects a loss of substrate binding affinity. But the Q157A mutation does not affect folding or structure in a significant manner
D61A
-
site-directed mutagenesis
E133A
-
site-directed mutagenesis
E54A
-
site-directed mutagenesis
E81A
-
site-directed mutagenesis
D61A
-
site-directed mutagenesis
-
E133A
-
site-directed mutagenesis
-
E54A
-
site-directed mutagenesis
-
E81A
-
site-directed mutagenesis
-
D1217N/D1614N
-
site-directed mutagenesis of Dicer-2
G31R
-
site-directed mutagenesis of Dicer-2
S300A
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S300A/S302A
-
site-directed mutagenesis, the double mutation completely disrupts nuclear localization
S300E
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S300E/S302D
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S302A
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S302D
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
D114A
-
mutant exhibits catalytic activity in vitro in 10 mM Mg2+ buffer that is comparable to that of the wild-type enzyme. At 1 mM Mg2+, the activity is significantly lower, KM-value for Mg2+ is about 2.8fold larger than the wild-type value
D128A
site-directed mutagenesis, the D128A mutation in both RNase III subunits, D128A/D128'A, causes an 83fold increase in KD in the interaction of RNase III with YmdB
D45A
-
mutant enzyme exhibits negligible activity, regardless of the Mg2+ concentration
D45N
-
mutant enzyme exhibits negligible activity, regardless of the Mg2+ concentration
E100A
-
mutant enzyme requires higher Mg2+ concentrations for optimal activity than the wild-type enzyme
E117D
-
site-directed mutagenesis, mutant exhibits normal homodimeric behaviour, can bind substrates but shows highly reduced hydrolysis activity compared to the wild-type enzyme
E41A
-
mutant exhibits catalytic activity in vitro in 10 mM Mg2+ buffer that is comparable to that of the wild-type enzyme. At 1 mM Mg2+, the activity is significantly lower, KM-value for Mg2+ is about 2.8fold larger than the wild-type value
E41A/D114A
-
KM-value for Mg2+ is about 85fold larger than the wild-type value
E65A
-
mutant enzyme requires higher Mg2+ concentrations for optimal activity than the wild-type enzyme
G97E
-
increases requirement for Mg2+
Q153P
the Q153P substitution in the middle of the flexible linker between the endoND and the dsRBD abolish RNA-cleavage activity
S195A/S198A
site-directed mutagenesis, the mutant shows a slightly reduced phosphorylation level compared to wild-type
S33E/S34E
site-directed mutagenesis of phosphorylation sites, molecular dynamic simulations of the S33E/S34E double mutant, which formally provides the same double-negative charge as a single S33 or S34 phosphomonoester, indicate that an additional acidic residue at position 34 does not provide a stabilized interaction with R95. In contrast to the bidentate pS33-R95 side chain interaction, the observed salt bridge consists of a monodentate engagement of R95 with the E33 side chain, and no involvement of the E34 side chain. The S33E/S34E mutant shows abolished phosphorylation and cleaves R1.1 RNA with an efficiency comparable to, but not greater than unphosphorylated RNase III. The S33A/S34A double mutant is essentially fully resistant to phosphorylation
R206H
manipulations during cloning
D1709A
strongly reduced dsRNA cleavage activity
D1713A
no significant effect on the cleavage activity
D1713K
no significant effect on the cleavage activity
D1810A
reduced dsRNA cleavage activity
DELTA1787-1799
no significant effect on the cleavage activity
E1705A
reduced dsRNA cleavage activity
E1813A
strongly reduced dsRNA cleavage activity
K1790A
significantly reduced activity
K1790R
significantly reduced activity
K1790S
significantly reduced activity
K1790T
significantly reduced activity
D48A
site-directed mutagenesis, catalytically inactive mutant
E44A
site-directed mutagenesis, catalytically inactive mutant
D48A
Mycobacterium tuberculosis variant bovis Pasteur 1173P2
-
site-directed mutagenesis, catalytically inactive mutant
-
E44A
Mycobacterium tuberculosis variant bovis Pasteur 1173P2
-
site-directed mutagenesis, catalytically inactive mutant
-
K371A
dissociation constant for RNA is 2.1fold higher than the wild-type value
M368A
dissociation constant for RNA is 1.4fold higher than the wild-type value
M368E
dissociation constant for RNA is nearly identical to wild-type value
R372A
dissociation constant for RNA is nearly identical to wild-type value
S376E
dissociation constant for RNA is 1.3fold higher than the wild-type value
E125A
site-directed mutagenesis, the mutation does not compromise wild-type enzyme SmRNase III dimerization ability
E125Q
site-directed mutagenesis, mutation does not compromise wild-type enzyme SmRNase III dimerization ability
D63A
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
E135A
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
D63A
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
-
E135A
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
-
D218A
-
site-directed mutagenesis, inactive mutant
G238R
site-directed mutagenesis of KREPB10, the mutant has reduced steady-state levels compared to wild-type KREPB10
G238V
site-directed mutagenesis of KREPB10, the mutant has reduced steady-state levels compared to wild-type KREPB10
G270R
site-directed mutagenesis of KREPB9, the G270R mutant protein is considerably weaker due to the lower steady-state level
G270V
site-directed mutagenesis of KREPB9, mutant does not appear to shift compared to the wild-type
G238R
-
site-directed mutagenesis of KREPB10, the mutant has reduced steady-state levels compared to wild-type KREPB10
-
G238V
-
site-directed mutagenesis of KREPB10, the mutant has reduced steady-state levels compared to wild-type KREPB10
-
G270R
-
site-directed mutagenesis of KREPB9, the G270R mutant protein is considerably weaker due to the lower steady-state level
-
G270V
-
site-directed mutagenesis of KREPB9, mutant does not appear to shift compared to the wild-type
-
D44N
-
mutant enzyme with greatly reduced activity
D44N
-
mutant with greatly reduced activity
D44N
mutation of the cleavage site
D44N
site-directed mutagenesis, the mutation does not fully inactivate the enzyme, and dsRNA cleavage occurs during crystallization of the mutant enzyme
E110K
loss of Mg2+ binding capacity, non-functional, uncoupling of the dsRNA-binding and processing abilities of the enzyme
E110K
mutation of the cleavage site
E110Q
-
mutant enzyme has negligible RNA cleavage activity but retains its RNA binding affinity
E110Q
uncoupling of the dsRNA-binding and processing abilities of the enzyme
D45E
-
activity is partially rescued by Mn2+
D45E
-
mutant enzyme exhibits negligible activity, regardless of the Mg2+ concentration
E117Q
-
mutant enzyme can still bind to the substrate RNA in presence of Mg2+ but cannot cleave it
E117Q
-
site-directed mutagenesis, mutant exhibits normal homodimeric behaviour, can bind substrates but is unable to cleave the substrates
E38A
-
mutant enzyme requires higher Mg2+ concentrations for optimal activity than the wild-type enzyme
E38A
-
single amino acid substitution, preventing cleavage at the secondary site. RNase III(E38A) generates discrete-sized products
D70A
constructed point mutation, abolishes the catalytic activity of the protein but not its ability to bind to RNA substrates
D70A
-
constructed point mutation, abolishes the catalytic activity of the protein but not its ability to bind to RNA substrates
-
additional information
generation of null mutants for both genes RNC3 and RNC4 from the T-DNA insertion collection, termed rnc3-1 and rnc4-1, respectively, and of a double knockout mutant rnc3/4. Phenotypes, overview. rRNA deficiencies observed in rnc3/4 can be complemented by an RNC transgene
additional information
generation of null mutants for both genes RNC3 and RNC4 from the T-DNA insertion collection, termed rnc3-1 and rnc4-1, respectively, and of a double knockout mutant rnc3/4. Phenotypes, overview. rRNA deficiencies observed in rnc3/4 can be complemented by an RNC transgene
additional information
-
generation of null mutants for both genes RNC3 and RNC4 from the T-DNA insertion collection, termed rnc3-1 and rnc4-1, respectively, and of a double knockout mutant rnc3/4. Phenotypes, overview. rRNA deficiencies observed in rnc3/4 can be complemented by an RNC transgene
additional information
DELTAmrnC strain has no major difference in growth rate compared with wild-type, but reaches a slightly lower saturation density
additional information
-
DELTAmrnC strain has no major difference in growth rate compared with wild-type, but reaches a slightly lower saturation density
additional information
-
several pnp alleles constructed. Deletion DELTApnpL1001, which removes the upper (central) part of the large stem-loop (SL1) that serves as a substrate for RNase III
additional information
generation of an rnc null mutant in Borrelia burgdorferi that exhibits a pleiotropic phenotype, including decreased growth rate and increased cell length. The chromosomal rncBb gene is replaced through homologous recombination with the gentamicin resistance cassette flgBp-aacC1. Mutant rncBb operon structure. The RNase III mutant is viable but has altered processing of rRNA, phenotype, overview
additional information
-
generation of an rnc null mutant in Borrelia burgdorferi that exhibits a pleiotropic phenotype, including decreased growth rate and increased cell length. The chromosomal rncBb gene is replaced through homologous recombination with the gentamicin resistance cassette flgBp-aacC1. Mutant rncBb operon structure. The RNase III mutant is viable but has altered processing of rRNA, phenotype, overview
additional information
-
dcr-1 gene N-terminal deletion and null mutants show defective RNAi and are steril, overview
additional information
generation of a deletion mutant of gene cgR_1959, the DELTArnc mutant. Deletion of the rnc gene encoding RNase III results in cell elongation in Corynebacterium glutamicum strain R. Microarray analysis and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis show that the level of mraZ mRNA increases, whereas cgR_1596 and ftsEX mRNA are decreased in the DELTArnc mutant. RNase III cleaves the coding region of mraZ mRNA. Deletion of cgR_1596 caused a defect in cell separation. Phenotype, overview
additional information
-
generation of a deletion mutant of gene cgR_1959, the DELTArnc mutant. Deletion of the rnc gene encoding RNase III results in cell elongation in Corynebacterium glutamicum strain R. Microarray analysis and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis show that the level of mraZ mRNA increases, whereas cgR_1596 and ftsEX mRNA are decreased in the DELTArnc mutant. RNase III cleaves the coding region of mraZ mRNA. Deletion of cgR_1596 caused a defect in cell separation. Phenotype, overview
additional information
-
construction of a heterodimer comprising one functional wild-type subunit and one inactive E117Q mutant subunit, which carries the E117Q mutation allowing the mutant subunit to bind but not cleave the substrate, the functional subunit is sufficient for catalytic activity of the heterodimer
additional information
-
construction of a mutant enzyme RNase III[DELTAdsRBD] lacking the dsRNA binding domain, the mutant is still catalytically active at low salt concentrations in presence of either 25 mM Mg2+ or 5 mM Mn2+ with slightly reduced catalytic efficiency, but unaltered substrate specificity
additional information
-
construction of hybrid proteins consisiting of the N-terminal nuclease domain of Rhodobacter capsulatus and the C-terminal dsRNA-binding domain of Escherichia coli and vice versa, extension of the spacer region between the N-terminal and C-terminal domains does not alter the cleavage specificity
additional information
-
the stability of rpoS mRNA, and concomitantly the concentration of deltaS, are significantly higher in an RNase III-deficient mutant. Investigation of the dsrA mutant (rnc+dsrA-) and its isogenic variant lacking functional RNase III (rnc-dsrA-)
additional information
-
construction of mutant strain MG1655rnc-14::DELTATn10
additional information
-
construction of strain MG1655 rnc-14::DELTATn10 from wild-type straiin HT115
additional information
sequencing RNA from both an RNase III mutant (SK4455, rnc-14::DELTATn10 thyA715 rph-1) and the parental strain (MG1693, thyA715 rph-1) from which an RNase III mutant is derived
additional information
-
construction of strain MG1655 rnc-14::DELTATn10 from wild-type straiin HT115
-
additional information
-
construction of mutant strain MG1655rnc-14::DELTATn10
-
additional information
-
sequencing RNA from both an RNase III mutant (SK4455, rnc-14::DELTATn10 thyA715 rph-1) and the parental strain (MG1693, thyA715 rph-1) from which an RNase III mutant is derived
-
additional information
-
various deletion mutants of human Dicer
additional information
-
construction of mutant enzymes containing inserts encoding the enzyme's heparin binding region HBR1, HBR2, or HBR3 by site-directed mutagenesis, cytotoxicity of wild-type and mutant enzymes to Beas-2B cells, overview
additional information
an artificial small RNA (asRNA), composed of a Dicer-binding RNA element and an antisense RNA, can be used to induce Dicer to process and degrade a specific RNA. Development of a method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, MALAT-1 is selected as target and Hela and MDA-MB-231 cells are used as experimental models. The results of qRT-PCR show that the introduction of asRNA decreases the relative expression level of target gene significantly. Cell proliferation and cell migration are both suppressed remarkably after asRNA is expressed in Hela and MDA-MB-231 cells. T gene silencing effects were caused by Dicer. When the cleavage role of Dicer is silenced, the relative expression level of MALAT-1 is not affected after the introduction of asRNA. The effect of asRNA is dependent on Dicer. Method evaluation, overview
additional information
-
construction of hybrid proteins consisting of the N-terminal nuclease domain of Rhodobacter capsulatus and the C-terminal dsRNA-binding domain of Escherichia coli and vice versa
additional information
-
construction of deletion mutants RNT1DELTA2-329 and RNT1DELTA2-198, which are both catalytically active in vitro but do not rescue a growth defective mutant and are not able to retain activity and viability in vivo, construction of a AGNN-loop exchange mutant GNRA-loop shows reduced activity and substrate selectivity
additional information
-
construction of several deletion mutants, lacking parts or total of the C-terminus or N-terminus, deletion of the N-terminal domain leads to slight accumulation of unprocessed 25S pre-rRNA in vivo and reduced enzyme activity in vitro
additional information
-
building a class of RNA sensing actuation devices based on direct integration of RNA aptamers into a region of the RNase III Rnt1p hairpin that modulates Rnt1p cleavage rates, design of an Rnt1p switch platform based on direct replacement of the CEB with an aptamer sequence. Integration of a sensor component, DELTATCT-4 aptamer, into the actuator component, R31L-3B4Inv Rnt1p hairpin. Ligand binding to the integrated aptamer domain is associated with a structural change sufficient to inhibit Rnt1p processing, overview. Three tuning strategies based on the incorporation of different functional modules into the Rnt1p switch platform optimize switch dynamics and ligand responsiveness. Application of multiple switch modules decreases theophylline responsiveness and increases fold-change. The tuning modules can be implemented combinatorially in a predictable manner to further improve the regulatory response properties of the switch. The modularity and tunability of the Rnt1p switch platform will allow for rapid optimization and tailoring of this gene control device. Method evaluation and system stabililty, overview
additional information
-
construction of an enzyme deficient mutant which has a strongly reduced growth rate compared with the wild type, the sRNA MicA is found to be extremely stable in the deficiency mutant
additional information
an enzyme deletion mutant SmDELTArnc shows a symbiotic phenotype. Plants inoculated with the wild-type and complemented strains developed significantly longer shoots than those inoculated with the mutant bacteria, SmDELTArnc or SmDELTArnc (pSRK), which are similar to those of the control mock-treated plants
additional information
-
an enzyme deletion mutant SmDELTArnc shows a symbiotic phenotype. Plants inoculated with the wild-type and complemented strains developed significantly longer shoots than those inoculated with the mutant bacteria, SmDELTArnc or SmDELTArnc (pSRK), which are similar to those of the control mock-treated plants
additional information
-
rnc mutant (obtained by homologous recombination) is viable. Deletion of the rnc gene in Staphylococcus aureus does not affect cell growth in rich medium
additional information
-
construction of an RNase III inactivation mutant DELTArnc from Staphylococcus aureus strain 8325-4. The DELTArnc strain shows reduced extracellular protein levels and is less pathogenic compared with its parent strain
additional information
-
effect of mutations in the catalytic site of Staphylococcus aureus RNase III, overview
additional information
-
construction of an RNase III inactivation mutant DELTArnc from Staphylococcus aureus strain 8325-4. The DELTArnc strain shows reduced extracellular protein levels and is less pathogenic compared with its parent strain
-
additional information
-
effect of mutations in the catalytic site of Staphylococcus aureus RNase III, overview
-
additional information
-
creation of an RNase III null mutant of Streptococcus pyogenes by RNase III gene deletion
additional information
-
creation of an RNase III null mutant of Streptococcus pyogenes by RNase III gene deletion
-
additional information
Streptococcus pyogenes serotype 14
-
creation of an RNase III null mutant of Streptococcus pyogenes by RNase III gene deletion
additional information
Streptococcus pyogenes serotype 14 HSC5
-
creation of an RNase III null mutant of Streptococcus pyogenes by RNase III gene deletion
-
additional information
construction of a complemented DELTArnc strain
additional information
Streptococcus pyogenes serotype M1 SF370 (M1GAS)
-
construction of a complemented DELTArnc strain
-
additional information
generation of a disruption mutant of the chromosomal RNase III gene rnc by insertional mutagenesis, the mutant strain shows reduced actinomycin production. Complementation of mutant strain JSE1980 with pJSE1995 encoding the wild-type rnc gene restores actinomycin production to nearly wild-type levels
additional information
-
generation of a disruption mutant of the chromosomal RNase III gene rnc by insertional mutagenesis, the mutant strain shows reduced actinomycin production. Complementation of mutant strain JSE1980 with pJSE1995 encoding the wild-type rnc gene restores actinomycin production to nearly wild-type levels
-
additional information
-
constructed RNase III null mutant, phenotypic analysis
additional information
rnc null mutant of Streptomyces coelicolor M145 does not produce actinorhodin or undecylprodigiosin. The strain bearing the disrupted rnc gene was designated JSE1880
additional information
-
rnc null mutant of Streptomyces coelicolor M145 does not produce actinorhodin or undecylprodigiosin. The strain bearing the disrupted rnc gene was designated JSE1880
additional information
generation of the RNase III-deletion strain derivative M145 rnc::aac(3)IV, JSE1880 rnc-mutant strain, comparison of gene expression between the Streptomyces coelicolor M145 wild-type strain and the JSE1880 rnc-mutant strain. In silico search for sRNA genes adjacent to mRNAs that are upregulated in rnc mutant, detailed overview
additional information
-
generation of the RNase III-deletion strain derivative M145 rnc::aac(3)IV, JSE1880 rnc-mutant strain, comparison of gene expression between the Streptomyces coelicolor M145 wild-type strain and the JSE1880 rnc-mutant strain. In silico search for sRNA genes adjacent to mRNAs that are upregulated in rnc mutant, detailed overview
-
additional information
-
generation of the RNase III-deletion strain derivative M145 rnc::aac(3)IV, JSE1880 rnc-mutant strain, comparison of gene expression between the Streptomyces coelicolor M145 wild-type strain and the JSE1880 rnc-mutant strain. In silico search for sRNA genes adjacent to mRNAs that are upregulated in rnc mutant, detailed overview
-
additional information
-
generation of the RNase III-deletion strain derivative M145 rnc::aac(3)IV, JSE1880 rnc-mutant strain, comparison of gene expression between the Streptomyces coelicolor M145 wild-type strain and the JSE1880 rnc-mutant strain. In silico search for sRNA genes adjacent to mRNAs that are upregulated in rnc mutant, detailed overview
-
additional information
-
rnc null mutant of Streptomyces coelicolor M145 does not produce actinorhodin or undecylprodigiosin. The strain bearing the disrupted rnc gene was designated JSE1880
-
additional information
-
the catalytically inactive mutant RNase3-Ala can bind the substrates like 22 nt ds-siRNA or 60 bp dsRNA, formation of high-molecular-mass RNA-protein complexes
additional information
-
inducible knockdown of mRPN1 in Trypanosoma brucei results in loss of gRNA and accumulation of precursor transcripts, consistent with a role of mRPN1 in processing
additional information
generation of KREPB9 and KREPB10 null mutants. KREPB9 null cells show negligible differences in growth compared to parental 427 wild-type cells and single-knockout cells that retain KREPB9 expression. In KREPB10 null cells, growth is identical to single-knockout cells that retain KREPB10 expression, negligible differences from 427 wild-type cells
additional information
generation of KREPB9 and KREPB10 null mutants. KREPB9 null cells show negligible differences in growth compared to parental 427 wild-type cells and single-knockout cells that retain KREPB9 expression. In KREPB10 null cells, growth is identical to single-knockout cells that retain KREPB10 expression, negligible differences from 427 wild-type cells
additional information
-
generation of KREPB9 and KREPB10 null mutants. KREPB9 null cells show negligible differences in growth compared to parental 427 wild-type cells and single-knockout cells that retain KREPB9 expression. In KREPB10 null cells, growth is identical to single-knockout cells that retain KREPB10 expression, negligible differences from 427 wild-type cells
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.