Information on EC 3.1.26.3 - ribonuclease III

New: Word Map on EC 3.1.26.3
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Mark a special word or phrase in this record:
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)

The enzyme appears in viruses and cellular organisms

EC NUMBER
COMMENTARY
3.1.26.3
-
RECOMMENDED NAME
GeneOntology No.
ribonuclease III
REACTION
REACTION DIAGRAM
COMMENTARY
ORGANISM
UNIPROT
LITERATURE
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA
-
-
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
catalytic active site and substrate binding site structure and number determines the classification into classes I to III, overview
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
catalytic active site and substrate binding site structure and number determines the classification into classes I to III, overview, mechanism
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
determination of specific cleavage site, Glu117 is important for phosphodiester hydrolysis
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
Glu117 is essential for phosphodiester hydrolysis but not for substrate binding, the dsRNA-binding domain is important for substrate binding but not for catalytic activity, while the catalytic domain is important for catalytic activity but not for substrate binding
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
reaction mechanism, conserved Mn2+-dependent Glu117 is required, overview
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
RNA substrate forms a duplex structure with a terminal four-base loop with the sequence AGNN, being an important determinant of the substrate selectivity in the dsRNA binding domain dsRBD, the N-terminal region is not required for selective cleavage in vitro but required for full function and viability of yeast cells in vivo, substrate binding modeling
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
catalytic mechanism, overview. The enzyme activates water as a nucleophile to hydrolyze target site phosphodiesters, creating 3'-hydroxyl, 5'-phosphomonoester product termini
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
catalytic mechanism, overview. The enzyme activates water as a nucleophile to hydrolyze target site phosphodiesters, creating 3'-hydroxyl, 5'-phosphomonoester product termini
P9WH03
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
catalytic mechanism, overview. The enzyme activates water as a nucleophile to hydrolyze target site phosphodiesters, creating 3'-hydroxyl, 5'-phosphomonoester product termini
A8BQJ3
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
catalytic mechanism, overview. The enzyme activates water as a nucleophile to hydrolyze target site phosphodiesters, creating 3'-hydroxyl, 5'-phosphomonoester product termini, essential irreversibility of the hydrolytic step
-
endonucleolytic cleavage to a 5'-phosphomonoester
show the reaction diagram
catalytic mechanism, overview. The enzyme activates water as a nucleophile to hydrolyze target site phosphodiesters, creating 3'-hydroxyl, 5'-phosphomonoester product termini
Mycobacterium tuberculosis ATCC 35618
-
-
REACTION TYPE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
hydrolysis of phosphoric ester
-
-
-
-
SYNONYMS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
HCS protein
-
-
-
-
nuclease, ribo-, D
-
-
-
-
p241
-
-
-
-
ribonuclease D
-
-
-
-
RNase D
-
-
-
-
RNase O
-
-
-
-
CAS REGISTRY NUMBER
COMMENTARY
78413-14-6
-
ORGANISM
COMMENTARY
LITERATURE
UNIPROT
SEQUENCE DB
SOURCE
class 1 RNase III enzyme
-
-
Manually annotated by BRENDA team
prokaryotic RNases III are class I enzymes containing a single endonuclease domain linked to a double-stranded RNA binding domain
-
-
Manually annotated by BRENDA team
Columbia Col 0 ecotype, three different proteins named AtRTL1-AtRTL3
-
-
Manually annotated by BRENDA team
Dicer, a class III RNase III containing an N-terminal ATP-dependent RNA helicase domain, a PAZ motif, and 2 C-terminal endonuclease domains followed by a single dsRNA binding domain
-
-
Manually annotated by BRENDA team
gene rnc
-
-
Manually annotated by BRENDA team
strain W168 and strain yazCdd (SSB1044)
UniProt
Manually annotated by BRENDA team
several strains used
-
-
Manually annotated by BRENDA team
Dicer, a class III RNase III containing an N-terminal ATP-dependent RNA helicase domain, a PAZ motif, and 2 C-terminal endonuclease domains followed by a single dsRNA binding domain
-
-
Manually annotated by BRENDA team
Dicer, a class III RNase III containing an N-terminal ATP-dependent RNA helicase domain, a PAZ motif, and 2 C-terminal endonuclease domains followed by a single dsRNA binding domain
-
-
Manually annotated by BRENDA team
; K12
SwissProt
Manually annotated by BRENDA team
class 1 RNase III enzyme
-
-
Manually annotated by BRENDA team
gene rnc
-
-
Manually annotated by BRENDA team
gene rnc, strain JM109, recombinant hybrid enzymes consisiting of the N-terminal nuclease domain of Rhodobacter capsulatus and the C-terminal dsRNA-binding domain of Escherichia coli, and vice versa
-
-
Manually annotated by BRENDA team
MG1655, gene rnc
UniProt
Manually annotated by BRENDA team
mutant strains AB301,105, TS241 RNase III deficient
-
-
Manually annotated by BRENDA team
prokaryotic RNases III are class I enzymes containing a single endonuclease domain linked to a double-stranded RNA binding domain
-
-
Manually annotated by BRENDA team
strain SDF204 and the isogenic RNase III (rnc) deficient strain SDF205
-
-
Manually annotated by BRENDA team
Escherichia coli K12
K12
SwissProt
Manually annotated by BRENDA team
Escherichia coli MG1655
-
-
-
Manually annotated by BRENDA team
Escherichia coli MG1655rnc
gene rnc
-
-
Manually annotated by BRENDA team
class 3 RNase III enzyme
-
-
Manually annotated by BRENDA team
-
SwissProt
Manually annotated by BRENDA team
class 2 RNase III enzyme
-
-
Manually annotated by BRENDA team
Dicer, a class III RNase III containing an N-terminal ATP-dependent RNA helicase domain, a PAZ motif, and 2 C-terminal endonuclease domains followed by a single dsRNA binding domain
-
-
Manually annotated by BRENDA team
alphaPax6cre mice
-
-
Manually annotated by BRENDA team
Mycobacterium tuberculosis ATCC 35618
-
UniProt
Manually annotated by BRENDA team
Paramecium bursaria Chlorella virus-1
i.e. PBCV-1, gene a464r
-
-
Manually annotated by BRENDA team
identification of a novel rat mRNA sequence that is highly homologous to human ribonuclease III by differential display
SwissProt
Manually annotated by BRENDA team
gene rnc, strain 37b4, recombinant hybrid enzymes consisiting of the N-terminal nuclease domain of Rhodobacter capsulatus and the C-terminal dsRNA-binding domain of Escherichia coli, and vice versa
-
-
Manually annotated by BRENDA team
Rock bream iridovirus RBIV
RBIV
UniProt
Manually annotated by BRENDA team
class 1 RNase III enzyme
-
-
Manually annotated by BRENDA team
Saccharomyces cerevisiae ATCC 204508
-
SwissProt
Manually annotated by BRENDA team
serovar Typhimurium strain SL1344
-
-
Manually annotated by BRENDA team
strain SL1344 and derivatives thereof
-
-
Manually annotated by BRENDA team
Staphylococcus aureus 8325-4
-
-
-
Manually annotated by BRENDA team
Staphylococcus aureus RN6390
gene mc
-
-
Manually annotated by BRENDA team
M1 serotype
-
-
Manually annotated by BRENDA team
Streptococcus pyogenes SF370
M1 serotype
-
-
Manually annotated by BRENDA team
Streptomyces antibioticus IMRU 3720
gene rnc
UniProt
Manually annotated by BRENDA team
J15501 wild-type strain and C120 absB mutant strain
UniProt
Manually annotated by BRENDA team
Streptomyces coelicolor M145
M145
UniProt
Manually annotated by BRENDA team
synthetic construct
-
-
-
Manually annotated by BRENDA team
-
UniProt
Manually annotated by BRENDA team
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
evolution
-
mRPN1 is a homologue of the REN endonucleases
evolution
-
Tm-RNase III cleaves an Ec-RNase III substrate with identical specificity and is inhibited by antideterminant bp that also inhibit Ec-RNase III, indicating the conservation, across a broad phylogenetic distance, of positive and negative determinants of reactivity of bacterial RNase III substrates
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as RNase III in Escherichia coli. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
class I enzymes are the simplest, consisting of those found in bacteria and simple eukaryotes, such as Rnt1 in Saccharomyces cerevisiae. These are thought to be the antecedents of the more complex class II Drosha and class III Dicer proteins. Class I enzymes achieve the dimeric catalytic RNase III module by forming dimers, whereas the more complex class II and III members use intramolecular dimerization of their two RNase III domains
evolution
-
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
P9WH03
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
A8BQJ3
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
-
the enzyme belongs to the the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
evolution
-
the enzyme is a member of the ribonuclease III (RNase III) family
evolution
-
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases
evolution
U3GP13
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases. Streptomyces coelicolor and Streptomyces antibioticus are not closely related species within the genus
evolution
-
the virus-encoded RNase3 binds dsRNA as a dimer, which is the active form able to accommodate dsRNA binding and cleavage, and supports the classification of RNase3 as a class 1 RNase III endoribonuclease
evolution
Streptomyces antibioticus IMRU 3720
-
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases. Streptomyces coelicolor and Streptomyces antibioticus are not closely related species within the genus
-
evolution
Mycobacterium tuberculosis ATCC 35618
-
the enzyme belongs to the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Domain structures of ribonuclease III family polypeptides, overview
-
evolution
Saccharomyces cerevisiae ATCC 204508
-
the enzyme is a member of the ribonuclease III (RNase III) family
-
evolution
Staphylococcus aureus RN6390
-
the enzyme RNase III is a member of the ubiquitous family of double-strand-specific endoribonucleases
-
malfunction
-
dicer conditional knock-out retinas show developmental changes at embryonic day 16. In the absence of dicer in the embryonic retina, production of early generated cell types (ganglion and horizontal cells) is increased, and markers of late progenitors are not expressed. This phenotype persists into postnatal retina, in which the dicer-deficient progenitors fail to generate late-born cell types such as rods and Mller glia but continue to generate ganglion cells. Increase in apoptosis in dicer-deficient retinas. Most dicer-deficient cells die by adulthood. Postnatal day 5 dicer conditional knock-out retinas show a similar phenotype as that found at postnatal day 1. Select micro-RNAs are lost from dicer conditional knock-out areas at embryonic day 16
malfunction
-
on silencing drosha, a critical effector of micro-RNA maturation, significant inhibition of normal development and hatching in short interfering (si)RNA-soaked eggs. Drosha knockdown proves embryonically lethal. Impact of silencing dicer substantial up-regulates dicer transcript abundance, which does not impact on egg differentiation or hatching rates. Soaking the J2s in dicer siRNA results in a modest decrease in dicer transcript abundance which has no observable impact on phenotype or behaviour within 48 h of initial exposure to siRNA
malfunction
-
inducible knockdown of mRPN1 in Trypanosoma brucei results in loss of gRNA and accumulation of precursor transcripts, consistent with a role of mRPN1 in processing
malfunction
-
the rnc RNase III mutant strain has reduced levels of one of the full-length GadY-dependent bands. However, this mutant does not abolish processing, indicating redundancy with respect to enzymes capable of catalyzing GadY-directed processing
malfunction
U3GP13
a gene disruption mutant strain does not produce full-length or truncated forms of RNase III and grows more vigorously than its parent on actinomycin production medium but produces significantly lower levels of actinomycin. Complementation of the rnc disruption with the wild-type rnc gene from Streptomyces antibioticus restores actinomycin production to nearly wild-type levels
malfunction
-
blocking of RNase III processing by mutation of the processing site eliminates post-transcriptional osmoregulation of proU
malfunction
-
Drosha knockdown, but not Dicer knockdown, in stromal cells leads to a partial stall in the G1 phase of the cell cycle. In the absence of regulation by Drosha, neurogenin 2, Ngn2, accumulates resulting in a loss of stem cell fidelity and ultimately neuronal degeneration, the phenotype is independent of miRNAs. Non-redundant phenotypes caused by Drosha or Dicer deficiency occur most commonly in progenitor populations as opposed to mature, differentiated cell types. Knockdown of either Drosha or Dicer in human cells permits aberrant DNA replication and cell division in DNAdamage-induced senescent cells
malfunction
-
Drosha knockdown, but not Dicer knockdown, in stromal cells led to a partial stall in the G1 phase of the cell cycle. In the absence of regulation by Drosha, neurogenin 2, Ngn2, accumulates resulting in a loss of stem cell fidelity and ultimately neuronal degeneration, the phenotype is independent of miRNAs. Non-redundant phenotypes caused by Drosha or Dicer deficiency occur most commonly in progenitor populations as opposed to mature, differentiated cell types
malfunction
-
enzyme-deficient CRC cells show a reduced number of alkaline phosphatase-positive reprogrammed cells than wild-type cells, phenotype analysis of enzyme-deficient mutant HCT116 and DLD-1 cancer cell lines, overview. Transfection of specific transcription factors, such as Oct4, Sox2, Klf4 and c-Myc, or of miR-302s results in a considerable modulation of the malignant phenotypes of cancer cells, i.e. invasion, cell growth, tumorigenicity, and sensitivity to chemotherapeutic reagents and differentiation reagents, such as vitamins
malfunction
B1XB41
gene rnc deletion mutants are slow in rRNA operon induction and synthetically lethal with gene fis, encoding the transcriptional regulator Fis. In the absence of RNase III, not only the double pre-rRNP length gradient is lost but also the relative RNA polymerase occupancy in the spacer and nonspacer regions are approximately similar
malfunction
-
in the absence of RNase III, only trace amounts of 30S rRNA precursor are observed in Bacillus subtilis. A significant increase in the steady-state levels of the type I toxin mRNA txpA occurs in strains depleted for RNase III. Expression of the txpA and yonT toxin mRNAs account for the lethality of the Skin and SPbeta prophages in RNase III mutants
malfunction
-
non-redundant phenotypes caused by Dicer deficiency occur most commonly in progenitor populations as opposed to mature, differentiated cell types
malfunction
Streptomyces antibioticus IMRU 3720
-
a gene disruption mutant strain does not produce full-length or truncated forms of RNase III and grows more vigorously than its parent on actinomycin production medium but produces significantly lower levels of actinomycin. Complementation of the rnc disruption with the wild-type rnc gene from Streptomyces antibioticus restores actinomycin production to nearly wild-type levels
-
metabolism
-
the enzymes that catalyze the final steps of rRNA maturation, RNase J1, Mini-III and RNase M5, function efficiently without prior RNase III action
metabolism
-
the RNase III-mediated regulatory pathway functions to modulate corA expression and, in turn, the influx of metal ions transported by CorA in Escherichia coli
metabolism
-
two tandem RNase III cleavage sites determine betT mRNA stability in response to osmotic stress. The betT gene forms part of the osmoregulatory system Bet regulon, which participates in the synthesis of glycine betaine from externally supplied choline. BetT protein belongs to the betaine-choline-carnitine transporter family. The enzyme affects also the choline-uptake proU transporter system
metabolism
Escherichia coli MG1655
-
the RNase III-mediated regulatory pathway functions to modulate corA expression and, in turn, the influx of metal ions transported by CorA in Escherichia coli
-
physiological function
-
dicer contains the PAZ domain. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
dicer is necessary for the developmental change in competence of the retinal progenitor cells
physiological function
-
drosha does not contain the PAZ domain while dicer does. Drosha is almost identical among vertebrates. RNase III domain A is very conserved in vertebrates. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
drosha does not contain the PAZ domain while dicer does. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
drosha does not contain the PAZ domain. Taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
taxonomic-dependent evolution of the RNA-mediated gene silencing pathways, in which members of ribonuclease III family play important roles
physiological function
-
base pairing of the GadY small RNA with the intergenic region of the gadX-gadW mRNA results in directed processing events within the region of complementarity. Multiple enzymes are involved in the GadYdirected cleavage including the double-strand RNA-specific endoribonuclease RNase III, mechanism of regulation, overview
physiological function
-
cleavage of double-stranded RNA by ribonuclease III is a conserved early step in bacterial rRNA maturation, mechanism of dsRNA cleavage by RNase III, overview
physiological function
-
DICER is an RNase III family endoribonuclease that processes precursor microRNAs and long double-stranded RNAs, generating microRNA duplexes and short interfering RNA duplexes with 20-23 nucleotides in length
physiological function
-
Dicer-2 is a dsRNA-stimulated ATPase that hydrolyzes ATP to ADP. Dicer-2 generates small interfering RNAs, siRNAs, from long double-stranded RNA, dsRNA
physiological function
-
HvAV-3e RNase III is essential for virus DNA replication and infection using RNA interference-mediated gene silencing. RNase III is essential for virus pathology and DNA replication
physiological function
-
recombinant mRPN1 is a dimeric dsRNA-dependent endonuclease that requires Mg2+, a critical catalytic carboxylate, and generates 2-nucleotide 3' overhangs. Minicircles in the mitochondrial genome encode hundreds of small guide RNAs, gRNAs, that partially anneal with unedited mRNAs and direct the extensive editing. Trypanosoma brucei gRNAs and mRNAs are transcribed as polycistronic precursors, which undergo processing preceding editing. The mitochondrial RNA precursor-processing endonuclease 1, mRPN1, is involved in gRNA biogenesis, overview
physiological function
-
ribonuclease III cleaves double-stranded structures in bacterial RNAs and participates in diverse RNA maturation and decay pathways, RNase III mechanism of dsRNA cleavage, overview
physiological function
-
Rnt1p, the major RNase III in Saccharomyces cerevisiae, cleaves RNA substrates containing hairpins capped by A/uGNN tetraloops, using its dsRBD to recognize a conserved tetraloop fold
physiological function
-
role of endoribonucleases III and E in Salmonella typhimurium sRNA MicA regulation, MicA is a trans-encoded small non-coding RNA, which downregulates porin-expression in stationaryphase. RNase III regulates MicA in a target-coupled way, while RNase E controls free MicA levels in the cell, mechanisms, overview. ompA expression is regulated by RNase III and is dependent on MicA, and degradation of both the sRNA MicA and the ompA target mRNA is dependent on RNase III
physiological function
-
Staphylococcus aureus ribonuclease III belongs to the enzyme family known to degrade double-stranded RNAs. RNase III can regulate the pathogenicity of Staphylococcus aureus by influencing the level of extracellular proteins via two different ways respectively at different growth phases. During the lag phase of the bacterial growth cycle RNase III can influence the extracellular protein secretion via regulating the expression of secY2, one component of accessory secretory (sec) pathway. After Staphylococcus aureus cells grow to exponential phase, RNase III can regulate the expression of extracellular proteins by affecting the level of RNAIII
physiological function
-
the RNaseIII enzyme Drosha plays a pivotal role in microRNA, miRNA, biogenesis by cleaving primary miRNA transcripts to generate precursor miRNA in the nucleus. Nuclear localization of Drosha is critical for its functionality in miRNA processing
physiological function
-
tracrRNA directs the maturation of repeat/spacer-derived short crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein. The maturation of crRNAs represents a key event in CRISPR activation, all components are essential to protect Streptococcus pyogenes against prophage-derived DNA. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III or the related eukaryotic Dicer and Drosha enzymes
physiological function
-
enzyme RNase III cleavage at A and B sites of mltD mRNA regulates mltD degradation,
physiological function
-
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
P9WH03
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
A8BQJ3
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
-
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs. RNase III is negatively regulated by the macrodomain protein, YmdB, and might be dependent upon the direct interaction of the two proteins. The enzyme's catalytic activity is also subject to positive regulation. The T7 bacteriophage expresses a protein kinase that phosphorylates RNase III and enhances catalytic activity about fourfold, as measured in vitro
physiological function
-
the dsRNA-specific class 1 RNase III-like endoribonuclease encoded by sweet potato chlorotic stunt virus suppresses posttranscriptional gene silencing and eliminates antiviral defence in sweet potato plants in an endoribonuclease activity-dependent manner
physiological function
-
the enzyme has a broad function in gene regulation in response to stress and during host infection of Staphylococcus aureus. RNase III-mediated cleavage in the 5' untranslated region enhances the stability and translation of cspA mRNA, which encodes the major cold-shock protein. Processing of cspA mRNA by the enzyme activates CspA synthesis. RNase III cleaves overlapping 5'-UTRs of divergently transcribed genes to generate leaderless mRNAs, which constitutes a distinct way to co-regulate neighboring genes. RNase III initiates maturation of rRNA operons. In addition to gene regulation, the enzyme is associated with RNA quality control of pervasive transcription, complexity of post-transcriptional regulation mediated by RNase III, possible function of the enzyme in the decay of structured regions of mRNAs, overview
physiological function
-
the enzyme is a critical miRNA processing enzyme, miRNAs play crucial roles in developmental processes, stress response, stem cell physiology, and diseases such as cancer
physiological function
-
the enzyme is involved in RNA quality control. Processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
physiological function
U3GP13
the enzyme is required for and regulates antibiotic production
physiological function
-
the enzyme negatively regulates the expression of betT, the cleavage determines betT mRNA stability in vivo, osmoregulation of betT expression by RNase III
physiological function
-
the enzyme plays a role in the mechanism of RatA mediated degradation of txpA mRNA both in vivo and in vitro and in cleaving double-stranded RNA in many biological systems, it is involved in ribosomal RNA maturation and mRNA turnover. In contrast to other bacteria, the enzyme is essential in Bacillus subtilis, it protects the organism from the expression of toxin genes borne by two prophages, through antisense RNA, although it is not responsible for the stabilities of antisense-RNAs. Degradation of type I toxin txpA is dependent on both RatA and RNase III. The organism uses RNase III or its homologues as part of viral defense or viral accommodation mechanisms
physiological function
B1XB41
the enzyme plays a role in the rapid induction of ribosomal operons during outgrowth and is essential in the absence of the transcriptional regulator Fis, suggesting a linkage of transcription and RNA processing for ribosomal operons in Escherichia coli, the enzyme has an effect on ribosome operon transcription and is involved in the early process steps of rRNA biogenesis, overview The enzyme is required for localization of the 5 pre-rRNA leader to the nucleoid and for optimal induction of rRNA synthesis. RNase III processing of pre-rRNA occurs cotranscriptionally
physiological function
-
the enzyme RNase III initiates rapid degradation of proU mRNA upon hypoosmotic stress, osmoregulation occurs at a post-transcriptional level. Upon osmotic downshift, the enzyme immediately processes the proU mRNA which reduces its half-life from 65 sec to less than 4 sec
physiological function
-
the human enzyme has multiple functions including ribonucleolytic, heparan sulfate binding, cellular binding, endocytic, lipid destabilization, cytotoxic, and antimicrobial activities
physiological function
-
the ribonuclease III enzyme Dicer has a central role in the biogenesis of microRNAs and small interfering RNAs. Dicer also acts in the biogenesis of DNA-damage-associated small RNAs, overview. Additionally, Dicer has critical roles in genome regulation and surveillance, including the production of endogenous small interfering RNAs from many sources, and the degradation of potentially harmful short interspersed element and viral RNAs
physiological function
-
the ribonuclease III enzymes Drosha and Dicer have central roles in the biogenesis of ribosomal RNA, microRNAs and small interfering RNAs, including p53, Lin28, DEAD-box RNA helicases and Smads. In neuronal progenitors, Drosha normally binds and cleaves stem-loop structures within the 3' UTR of proneuronal transcription factor neurogenin 2, Ngn2. Drosha also recognizes and cleaves messenger RNAs, and Drosha is necessary for the maturation of ribosomal RNA. mRNA cleavage occurs via recognition of secondary stem-loop structures similar to miRNA precursors, and is an important mechanism of repressing gene expression, particularly in progenitor/stem cell populations. Drosha-mediated rRNA processing is implicated in regulating cell cycle progression in human multi-potent stromal cells. Drosha and Dicer act in the biogenesis of DNA-damage-associated small RNAs, overview. Dicer also has critical roles in genome regulation and surveillance, including the production of endogenous small interfering RNAs from many sources, and the degradation of potentially harmful short interspersed element and viral RNAs
physiological function
-
the ribonuclease III enzymes Drosha and Dicer have central roles in the biogenesis of ribosomal RNA, microRNAs and small interfering RNAs, including p53, Lin28, DEAD-box RNA helicases and Smads. In neuronal progenitors, Drosha normally binds and cleaves stem-loop structures within the 3' UTR of proneuronal transcription factor neurogenin 2, Ngn2. Drosha also recognizes and cleaves messenger RNAs, and is necessary for the maturation of rRNA. mRNA cleavage occurs via recognition of secondary stem-loop structures similar to miRNA precursors, and is an important mechanism of repressing gene expression, particularly in progenitor/stem cell populations. Drosha and Dicer act in the biogenesis of DNA-damage-associated small RNAs, overview. Dicer also has critical roles in genome regulation and surveillance, including the production of endogenous small interfering RNAs from many sources, and the degradation of potentially harmful short interspersed element and viral RNAs
physiological function
-
the steady-state levels of metal transporter corA mRNA as well as the degree of cobalt influx into the cell are dependent on cellular concentrations of the enzyme RNase III. Enzyme RNase III cleavage constitutes a rate-determining step for corA mRNA degradation, downregulation of corA expression by the enzyme, overview. Introduction of point mutations in RNase III cleavage sites C-122G, U-153A, and A-152G of corA mRNA abolishes the enzyme cleavage activity on corA mRNA and results in prolonged half-lives of the mRNA
physiological function
Streptococcus pyogenes SF370
-
tracrRNA directs the maturation of repeat/spacer-derived short crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein. The maturation of crRNAs represents a key event in CRISPR activation, all components are essential to protect Streptococcus pyogenes against prophage-derived DNA. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III or the related eukaryotic Dicer and Drosha enzymes
-
physiological function
Streptomyces antibioticus IMRU 3720
-
the enzyme is required for and regulates antibiotic production
-
physiological function
Mycobacterium tuberculosis ATCC 35618
-
processing of dsRNA by the enzyme is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs
-
physiological function
-
enzyme RNase III cleavage at A and B sites of mltD mRNA regulates mltD degradation,
-
physiological function
Staphylococcus aureus 8325-4
-
Staphylococcus aureus ribonuclease III belongs to the enzyme family known to degrade double-stranded RNAs. RNase III can regulate the pathogenicity of Staphylococcus aureus by influencing the level of extracellular proteins via two different ways respectively at different growth phases. During the lag phase of the bacterial growth cycle RNase III can influence the extracellular protein secretion via regulating the expression of secY2, one component of accessory secretory (sec) pathway. After Staphylococcus aureus cells grow to exponential phase, RNase III can regulate the expression of extracellular proteins by affecting the level of RNAIII
-
physiological function
Escherichia coli MG1655
-
the steady-state levels of metal transporter corA mRNA as well as the degree of cobalt influx into the cell are dependent on cellular concentrations of the enzyme RNase III. Enzyme RNase III cleavage constitutes a rate-determining step for corA mRNA degradation, downregulation of corA expression by the enzyme, overview. Introduction of point mutations in RNase III cleavage sites C-122G, U-153A, and A-152G of corA mRNA abolishes the enzyme cleavage activity on corA mRNA and results in prolonged half-lives of the mRNA
-
physiological function
Staphylococcus aureus RN6390
-
the enzyme has a broad function in gene regulation in response to stress and during host infection of Staphylococcus aureus. RNase III-mediated cleavage in the 5' untranslated region enhances the stability and translation of cspA mRNA, which encodes the major cold-shock protein. Processing of cspA mRNA by the enzyme activates CspA synthesis. RNase III cleaves overlapping 5'-UTRs of divergently transcribed genes to generate leaderless mRNAs, which constitutes a distinct way to co-regulate neighboring genes. RNase III initiates maturation of rRNA operons. In addition to gene regulation, the enzyme is associated with RNA quality control of pervasive transcription, complexity of post-transcriptional regulation mediated by RNase III, possible function of the enzyme in the decay of structured regions of mRNAs, overview
-
physiological function
Escherichia coli MG1655rnc
-
the enzyme negatively regulates the expression of betT, the cleavage determines betT mRNA stability in vivo, osmoregulation of betT expression by RNase III
-
metabolism
Escherichia coli MG1655rnc
-
two tandem RNase III cleavage sites determine betT mRNA stability in response to osmotic stress. The betT gene forms part of the osmoregulatory system Bet regulon, which participates in the synthesis of glycine betaine from externally supplied choline. BetT protein belongs to the betaine-choline-carnitine transporter family. The enzyme affects also the choline-uptake proU transporter system
-
additional information
-
detection of MicA sense transcripts in an RNase III-deficient antisense mutant dependent on ompA
additional information
-
Dicer-2 contains C-terminal RNase III domains that mediate RNA cleavage
additional information
-
four conserved catalytic side-chains E214, D218, D288, and E291
additional information
-
orf27 encodes an RNase III-like protein after infection and demonstrates dsRNA specific endoribonuclease activity of the encoded protein. The Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing
additional information
-
Q157 is a conserved glutamine in the Aa-RNase III dsRNA-binding domain
additional information
-
structure of RNase III double-stranded RNA binding domain complex with a noncanonical RNA substrate, analysis of the binding specificity, overview. The dsRBD adopts the same conformation in both the AAGU and AGAA complexes. The AAGU tetraloop in the complex adopts a backbone fold similar to that of the AGAA tetraloop
additional information
-
the RNA binding and enzymatic domains of Drosha are located on its C-terminus, the N-terminus harbors a nuclear localization signal
additional information
-
features of the Rnt1p-substrate interaction contributing to processing reactivity, overview. Structure analysis and comparison to other enzyme family members, overview
additional information
-
structure analysis and comparison to other enzyme family members, overview
additional information
P9WH03
structure analysis and comparison to other enzyme family members, overview
additional information
-
structure analysis and comparison to other enzyme family members, overview. Additional domains, including the dsRNA-binding and PAZ domains, that cooperate with the RNase III domain to select target sites, regulate activity, confer processivity, and support the recognition of structurally diverse substrates
additional information
A8BQJ3
structure analysis and comparison to other enzyme family members, overview. Additional domains, including the dsRNA-binding and PAZ domains, that cooperate with the RNase III domain to select target sites, regulate activity, confer processivity, and support the recognition of structurally diverse substrates
additional information
-
the dsRNA-binding domain and N-terminal domains of enzyme Rnt1p function as two rulers that measure the distance between the tetraloop and the cleavage site, mechanism, overview. Both rulers interact with the NGNN tetraloop: ruler 1 recognizes the Gua16 base, and ruler 2 secures the Gua16 recognition
additional information
-
the enzyme autoregulates its own expression. Contributions of residues E135 and D63 to the active site of the enzyme
additional information
-
the enzyme binds siRNA as a dimer, which is the active form able to accommodate dsRNA binding and cleavage
additional information
-
three putative multifunctional heparin binding regions, 34RWRCK38 (HBR1), 75RSRFR79 (HBR2), and 101RPGRR105 (HBR3), of hRNase3 are identified by silico sequence analysis and validated by in vitro activity assays, the heparin binding peptide containing HBR1 is a key element associated with heparan sulfate binding, cellular binding, and lipid binding activities. Comparisons of CHO cell binding and cytotoxicity to Beas-2B cells of wild-type and mutant enzymes, overview
additional information
Mycobacterium tuberculosis ATCC 35618
-
structure analysis and comparison to other enzyme family members, overview
-
additional information
Saccharomyces cerevisiae ATCC 204508
-
the dsRNA-binding domain and N-terminal domains of enzyme Rnt1p function as two rulers that measure the distance between the tetraloop and the cleavage site, mechanism, overview. Both rulers interact with the NGNN tetraloop: ruler 1 recognizes the Gua16 base, and ruler 2 secures the Gua16 recognition
-
additional information
Staphylococcus aureus RN6390
-
the enzyme autoregulates its own expression. Contributions of residues E135 and D63 to the active site of the enzyme
-
SUBSTRATE
PRODUCT                      
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
25S pre-rRNA + H2O
25S rRNA
show the reaction diagram
-
processing
-
-
?
35S pre-rRNA + H2O
mature 35S rRNA
show the reaction diagram
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
515 bp dsRNA + H2O
?
show the reaction diagram
-
Dicer-2 substrate is synthetic 515 bp dsRNA
-
-
?
Aa-[16S[micro-hp]RNA] + H2O
?
show the reaction diagram
-
structures of the Aquifex pre-16S and pre-23S rRNA processing stems and corresponding hairpin substrates, overview
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Q5YF04
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Q9X0I6
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
15 bases in average
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
no activity on DNA-RNA hybrids
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
RNase D activity in HIV-1 RT is contamination
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
reverse transcriptase of HIV-1 possesses RNase D activity
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
reverse transcriptase of HIV-1 possesses RNase D activity
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves scRNA, similar to signal recognition particle
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
dsRNA-specific endonuclease activity enhances the RNA-silencing suppression activity of another protein (p22) encoded by SPCSV. RNase3 and p22 coexpression reduce siRNA accumulation more efficiently than p22 alone in Nicotiana benthamiana leaves expressing a strong silencing inducer (i.e., dsRNA). RNase3 does not cause intracellular silencing suppression or reduce accumulation of siRNA in the absence of p22 or enhance silencing suppression activity of a protein encoded by a heterologous virus
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
the enzyme is able to process rRNAs and to regulate the levels of polynucleotide phosphorylase
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
Dicer is a multidomain ribonuclease that processes double-stranded RNAs (dsRNAs) to 21 nt small interfering RNAs (siRNAs) during RNA interference, and excises microRNAs from precursor hairpins. Dicer contains two domains related to the bacterial dsRNA specific endonuclease, RNase III, which is known to function as a homodimer. Enzyme has only one processing center, containing two RNA cleavage sites and generating products with 2 nt 3' overhangs. It is proposed that Dicer functions through intramolecular dimerization of its two RNase III domains, assisted by the flanking RNA binding domains, PAZ and dsRBD
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Q02555
the enzymatic activity requires a conserved catalytic domain, while RNA binding requires the double-stranded RNA-binding domain at the C-terminus of the protein. Rnt1p specifically cleaves RNAs that possess short irregular stem-loops containing 1214 base pairs interrupted by internal loops and bulges and capped by conserved AGNN tetraloops. A new carboxy-terminal helix following a canonical ds double-stranded RNA-binding domain structure allows the Rnt1p double-stranded RNA-binding domain to bind to short RNA stem-loops by modulating the conformation of helix a1, a key RNA-recognition element of the double-stranded RNA-binding domain
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
the observed interactions between helix alpha1 in the double-stranded RNA binding domain RNA complex in vitro are required for substrate recognition in the context of the entire protein in vivo. The endonuclease domain of Rnt1p is almost immediately N-terminal to the helix alpha1
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
enzyme plays multiple roles in the processing of rRNA and mRNA and strongly affects the decay of the sRNA MicA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, preferred substrate contains NGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
involved in the production of short interfering RNAs (siRNAs) and for the processing of precursor miRNAs (pre-miRNAs) into microRNAs (miRNAs)
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Q8R418
processing of precursor dsRNAs into mature microRNAs and small-interfering RNAs
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for processing and maturation of RNA precursors into functional rRNA, mRNA and other small RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for processing of dsRNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
P0A7Y0
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for the production of short interfering RNAs and microRNAs that induce gene silencing known as RNA interference
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
114 bp in length
products shorter than 21 bp
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops, new form of Rnt1p substrates identified lacking the conserved AGNN sequence but instead harboring an AAGU tetraloop was found at the 5' end of snoRNA 48 precursor
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Q8R418
in vitro dsRNA cleavage assay with a designed 52-nt stem-loop RNA containing a 24-bp stem capped by a GCAA tetraloop as the substrate
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
new form of Rnt1p substrates identified harboring an AAGU tetraloop at the 5' end of snoRNA 48 precursor, reactions performed under low salt (10 mM KCl) and physiological salt (150 mM KCl) conditions, construction of substrate containing a AAAU or UUGU structure instead of AAGU showed similar efficiency under low salt conditions but strongly reduced efficiency under physiological salt conditions, stem structure is found to partially contribute t the substrate binding efficiency
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Rock bream iridovirus RBIV
Q5YF04
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Escherichia coli K12
P0A7Y0
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
?
show the reaction diagram
-
2'-hydroxyl groups of nucleotides of the tetraloop or adjacent base pairs are predicted to interact with residues of alpha-helix 1 are important for Rnt1p cleavage in vitro
-
-
?
double-stranded RNA + H2O
?
show the reaction diagram
-
R1.1 RNA
-
-
?
double-stranded RNA + H2O
?
show the reaction diagram
-
RNA 5, a 30 base stem-loop RNA of the sequence 5 '-AUAAAGGUCAUUCGCAAGAGUGGCCUUUAU-3', is cleaved by RNase III (D44N) from Aquifex aeolicus. The products of the reaction include a dinucleotide 5'-AU-3' and a 28 base stem-loop RNA with a two-base 3' overhang (RNA 6). Two RNA 6 molecules and a dimeric mutant enzyme D44N molecule form a product complex
-
-
?
ds-rRNA + H2O
mature ds-rRNA
show the reaction diagram
-
-
-
-
?
ds-rRNA + H2O
mature ds-rRNA
show the reaction diagram
-
double-strand RNA specific endonuclease
-
-
?
dsDNA + H2O
?
show the reaction diagram
Rock bream iridovirus, Rock bream iridovirus RBIV
Q5YF04
-
-
-
?
dsRNA + H2O
?
show the reaction diagram
-
cleavage to short RNA pieces
-
-
?
dsRNA + H2O
?
show the reaction diagram
-
RNase III(E38A) generates discrete-sized products from long dsRNA
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
-
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
-
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
O31418
-
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
Paramecium bursaria Chlorella virus-1
-
model substrate
product determination
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
enzyme is involved in the maturation and decay of cellular, phage and plasmid RNAs
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
enzyme plays a key role in diverse maturation and degradation processes
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
obligatory step in the maturation and decay of diverse RNAs
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
reshaping of fully or partially double-stranded RNA precursors in to mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modificatin of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
diverse model RNA substreates, enzyme cleaves specifically RNA stems capped with the conserved AGNN tetraloop, the dsRNA sequence adjacent to the tetraloop regulates enzyme activity by interfering with substrate binding, sequences surrounding the cleavage site directly influence the cleavage efficiency, a minimum substrate length is required
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
double-strand RNA specific endonuclease
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
double-strand RNA-specific, the dsRNA-binding domain is important for substrate binding but not for catalytic activity, while the catalytic domain is important for catalytic activity but not for substrate binding
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
one functional monomer is sufficient for cleavage activity of the dimer
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
specific for double-stranded RNA, a dimerization signal within the N-terminal domain is required for efficient cleavage
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
Q9ZBQ7
members of tRNase III family, which have been implicated in the processing of pre-rRNA, rRNA, polycistronic mRNAs, and small regulatory RNAs, normally cleave duplex segments of RNAs configured as stem-loop structures and are ubiquitous among prokaryotes, eukaryotes, and archaea
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
process double-stranded RNAs consisting of two turns of the RNA helix. Although the enzyme plays a role in ribosomal RNA processing and gene regulation, enzyme is not essential for cell growth but regulates virulence gene expression
-
-
?
dsRNA + H2O
processed RNA
show the reaction diagram
-
-
-
-
?
dsRNA + H2O
processed RNA
show the reaction diagram
-
specific for double-stranded RNA
enzyme produces 12-15 base pair duplex products with 5'-phosphate, 3'-hydroxyl termini
-
?
hairpin RNA R1.1 + H2O
?
show the reaction diagram
-
RNase III(E38A) cleaves at the primary site and remains bound to the RNA, thereby preventing cleavage at the secondary site
-
-
?
mRNA + H2O
mature mRNA
show the reaction diagram
-
specific processing of several hairpin nemis+, i.e. Neisseria miniature insertion sequences, mini transcripts, enzyme/substrate interaction, substrate specificity, overview
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
reduces expression of itself
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
mRNA phage SP82 is cleaved by Bacillus subtilis, mRNA phage SP82 is not cleaved by E. coli RNase III
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
mRNA phage SP82 is not cleaved by E. coli RNase III
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
RNAI, a regulator of plasmid replication is cleaved
-
-
-
mRNA transcripts + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
to affect gene expression
-
-
?
poly(A)-poly(U) + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
poly(I C) + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
pre-16S rRNA + H2O
mature 16S rRNA
show the reaction diagram
-
-
-
-
?
pre-23S rRNA + H2O
mature 23S rRNA
show the reaction diagram
-
-
-
-
?
pre-23S rRNA + H2O
mature 23S rRNA
show the reaction diagram
O31418
-
-
-
?
pre-5S rRNA + H2O
mature 5S rRNA
show the reaction diagram
-
-
-
-
?
pre-mRNA + H2O
mature mRNA
show the reaction diagram
-
enzyme regulates gene expression by controlling mRNA translation and stability
-
-
?
pre-rRNA + H2O
mature rRNA
show the reaction diagram
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
show the reaction diagram
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
show the reaction diagram
-
enzyme is required for processing
-
-
?
pre-rRNA + H2O
mature rRNA
show the reaction diagram
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
show the reaction diagram
-
enzyme is required for processing
-
-
?
pre-snoRNA + H2O
mature snoRNA
show the reaction diagram
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
show the reaction diagram
-
enzyme is required for processing
-
-
?
pre-snRNA + H2O
mature snRNA
show the reaction diagram
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
premicro-RNA + H2O
mature micro-RNA
show the reaction diagram
synthetic construct
-
RNase III treatment causes a preferential loss of RNA in the 50- to 100-nt region. After RNase III treatment, the ratio of pre- to mature micro-RNA is reduced for micro-RNAs such as hsa-let-7b and hsa-let-7g, in both conditioned medium and mesenchymal stem cells due to a decrease in premicro-RNA level coupled with a concomitant increase in mature micro-RNA level
-
-
?
R1.1 RNA + H2O
2 fragment of R1.1 RNA
show the reaction diagram
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
2 fragments of R1.1 RNA
show the reaction diagram
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
2 fragments of R1.1 RNA
show the reaction diagram
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early regionbetween genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
show the reaction diagram
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, recombinant substrate from in vitro transcription, determination of cleaving positions for the recombinant hybrid enzyme mutants
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
show the reaction diagram
Paramecium bursaria Chlorella virus-1
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, several cleavage sites
product determination
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
show the reaction diagram
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, several derivatives containing an internal loop
product determination
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
show the reaction diagram
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, substrate possesses 2 ethidium bromide binding sites in the internal loop and the lower stem, respectively, both consisting of an A-A pair stacked on a CG pair, which is a motif that is a favourable environment for intercalation
-
-
?
R1.1 RNA + H2O
?
show the reaction diagram
-
-
-
-
?
R1.1 RNA derivatives + H2O
fragments of R1.1 RNA
show the reaction diagram
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, derivative R1.1[CL3B] is not cleaved and its binding to the enzyme leads to uncoupling of substrate recognition and cleavage
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
show the reaction diagram
-
-
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
show the reaction diagram
-
no activity on 23S RNA and 16S RNA
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
show the reaction diagram
-
the small and stable 10Sa RNA is cleaved
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
show the reaction diagram
-
7S RNA is cleaved
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
show the reaction diagram
-
23S RNA in Rhodobacter capsulatus
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
show the reaction diagram
-
initiates maturation of 23S and 16S RNA species
-
-
?
RNA precursor + H2O
mature RNA
show the reaction diagram
-
phage lambda RNA, enzyme is involved in translation control
-
-
?
RNA substituted with guanosine 5'-O-(1-thiotriphosphate) + H2O
5'-phosphooligonucleotides containing guanosine 5'-O-(1-thiotriphosphate)
show the reaction diagram
-
cleavage specifity is not altered by modified RNA
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Q5YF04
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
E. coli infected with bacteriophage T4 deletion mutant
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Rock bream iridovirus RBIV
Q5YF04
-
-
-
?
synthetic 25S rRNA 3' ETS cleavage site containing RNA + H2O
?
show the reaction diagram
-
-
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
-
tRNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
no activity on yeast tRNA
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
HIV-1 RT displays the same cleavage specifity as RNase D
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
initiates maturation of phage T4 tRNA
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
five additional secondary cleavage sites in RNA A3t from bacteriophage T7
-
-
?
mature 23S rRNA
23S pre-rRNA + H2O
show the reaction diagram
-
-
-
-
?
additional information
?
-
-
enzyme is essential, and is involved in RNA interference, i.e. RNAi, a post-transcriptional gene-silencing phenomenon, and germ line development
-
-
-
additional information
?
-
-
enzyme is involved in RNA processing and RNA interference, i.e. RNAi, regulation by a combination of primary and tertiary structural elements allowing a substrate-specific binding and cleavage efficiency
-
-
-
additional information
?
-
-
involved in the maturation of the ribosomal RNA precursor, and bacteriophage T7 mRNA precursors, enzyme participates in the degradation as well as maturation of diverse cellular, phage, and plasmid RNAs
-
-
-
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
phylogenetic analysis, enzyme might be important for virus replication
-
-
-
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
-
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other species, overview
-
-
-
additional information
?
-
-
no activity with (rA)25, (rU)25, (rC)25, dsDNA, ssDNA and an RNA-DNA hybrid
-
-
-
additional information
?
-
-
RNA structure-dependent uncoupling of substrate recognition and cleavage, in vitro selection and structure determination of cleavage resistant variants of T7 R1.1 RNA classes I and II, due to altered conformation, overview
-
-
-
additional information
?
-
-
specificity for A-form dsRNA, enzyme is loosely associated with ribosomes
-
-
-
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
substrate cleavage specificity
-
-
-
additional information
?
-
-
substrate specificity of the recombinant hybrid enzyme mutants, substrate specificity is determined by the catalytic N-terminus of the enzyme
-
-
-
additional information
?
-
-
substrate specificity with diverse RNA mutant substrate variants, the RNA internal loop, in which is located the required single scissile phosphodiester, is the reactivity epitope the substrates, overview
-
-
-
additional information
?
-
-
substrate specificity, overview, RNA substrate with introduced sequences stabilizing the RNA helix enhances binding while the turnover rate is reduced, thus substrate binding becomes rate-limiting
-
-
-
additional information
?
-
-
RNAIII and the endoribonuclease III coordinately regulate spa gene expression
-
-
-
additional information
?
-
Q02555
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
-
additional information
?
-
-
specificity of cleavage by Rnt1p relies on the presence of RNA tetraloop structures with the consensus sequence AGNN at the top of the target dsRNA. Identification of exocyclic groups of purines in the major groove downstream of the tetraloop as a major antideterminant in RNase III activity
-
-
-
additional information
?
-
P0A7Y0
as a binding protein, RNase III binds and stabilizes certain RNAs, thus suppressing the expression of certain genes
-
-
-
additional information
?
-
-
required for 3external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo
-
-
-
additional information
?
-
-
ability of Dicer C-terminus to interact with 5-lipoxygenase
-
-
-
additional information
?
-
-
Dicer functions as a dsRNA-processing enzyme, producing small interfering RNA (siRNA). Dicer plays important roles in RNA processing, posttranscriptional gene expression control, and defense against virus infection. Bacterial RNase III functions not only as a processing enzyme, but also as a binding protein that binds dsRNA without cleaving it
-
-
-
additional information
?
-
Q9ZBQ7
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
-
additional information
?
-
O31418
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
-
additional information
?
-
Q9ZBQ7
Streptomyces coelicolor absB gene encodes an RNase III family endoribonuclease and is essential for antibiotic biosynthesis. AbsB controls its own expression by sequentially and site specifically cleaving stem-loop segments of its polycistronic transcript
-
-
-
additional information
?
-
-
the gene encoding RNase III in Streptomyces coelicolor is transcribed during exponential phase and is required for antibiotic production and for proper sporulation
-
-
-
additional information
?
-
-
cleave internally 32P-labeled R1.1(WC) RNA
-
-
-
additional information
?
-
-
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
-
additional information
?
-
Q9X0I6
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
-
additional information
?
-
-
design of series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate is engineered to carry a single or multiple 2'-O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Introduction of 2'-O-methyl ribonucleotides near the cleavage site increases the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'-O-methyl ribonucleotides inhibits cleavage while single 2'-fluoro ribonucleotide substitutions does not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated
-
-
-
additional information
?
-
-
RNase III creates the substrate for PNPase that degrades the small RNA37, thus destroying the double-stranded 5' stem
-
-
-
additional information
?
-
-
Dicer-1 and Dicer-2 show different substrate specificity in vivo: Dicer-2 generates small interfering RNAs, siRNAs, from long double-stranded RNA, dsRNA, whereas Dicer-1 produces microRNAs, miRNAs, from pre-miRNA. Dicer-2 can efficiently cleave pre-miRNA in vitro, but phosphate and the Dicer-2 partner protein R2D2 inhibit pre-miRNA cleavage in vivo. Wild-type Dicer-2, but not a mutant defective in ATP hydrolysis, can generate siRNAs faster than it can dissociate from a long dsRNA substrate. Dicer-1 does not efficiently process long dsRNA
-
-
-
additional information
?
-
-
endonuclease mRPN1 directly binds with TbRGG2 and exhibits a nuclease-resistant association with two more proteins, 4160 and 8170, it might modulate gRNA utilization by editing complexes
-
-
-
additional information
?
-
-
in vitro RNase III is active with MicA when it is in complex with its targets, ompA or lamB mRNAs. MicA is cleaved by RNase III in a coupled way with ompA mRNA
-
-
-
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
-
additional information
?
-
-
Rnt1p, the major RNase III in Saccharomyces cerevisiae, cleaves RNA substrates containing hairpins capped by A/uGNN tetraloops, using its double-stranded RNA binding domains, dsRBD, to recognize a conserved tetraloop fold. The dsRBD adopts the same conformation in both the AAGU and AGAA complexes
-
-
-
additional information
?
-
-
small hairpins based on the stem structures associated with the Aquifex 16S and 23S rRNA precursors are cleaved at sites that are consistent with production of the immediate precursors to the mature rRNAs. Substrate reactivity is independent of the distal box sequence, but is strongly dependent on the proximal box sequence. RNase III mechanism of dsRNA cleavage, overview
-
-
-
additional information
?
-
-
two-step cleavage of hairpin RNA with 5' overhangs, recombinant DICER protein processes a hairpin RNA with 5' overhangs in vitro and generates an intermediate duplex with a 29 nt-5' strand and a 23 nt-3' strand. Longer 5' overhangs with stable stem structures can reduce the efficiency or rate of substrate cleavage. In vitro two-step processing of the 5'-end labelled pre-mmu-mir-1982 RNA by recombinant DICER protein, overview
-
-
-
additional information
?
-
-
recombinant mRPN1 is a dimeric dsRNA-dependent endonuclease that generates 2-nucleotide 3' overhangs, cleavage specificity of mRPN1 is reminiscent of bacterial RNase III and thus is fundamentally distinct from editing endonucleases, overview
-
-
-
additional information
?
-
-
RNase III cleaves dsRNA
-
-
-
additional information
?
-
-
substrate is bdm mRNA with recombinant His-tagged RNase III. Introduction of random mutations at the RNase III cleavages sites in bdm mRNA alter the enzyme activity, secondary structures and the stability of hairpins containing the RNase III cleavage sites 3 and 4-II, and RNase II cleavage patterns, overview
-
-
-
additional information
?
-
-
substrate is dsRNA specific to the HvAV-3e Bro11 and GFP genes. For small RNA cleavage, siRNA duplexes 21 nucleotides in length is used. The sequences of the oligonucleotides are the siRNA duplex-25 GUCCGGAUACUCUUUGCGGAC and siRNA duplex-11 GGAGGAAGAAAGGAGAAAGGA
-
-
-
additional information
?
-
-
substrate specificity with RNA duplex substrates, overview. The proximal box is a primary reactivity epitope for Tm-23S[hp] RNA. a CG or GC bp substitution at pb position 2 reduces the relative reactivity to 0.1 and 0.3, respectively, while a CG or GC substitution at pb position 4 provides a relative reactivity of 0.1 or 0.4, respectively. At pb position 3, only the AU bp substitution causes a significant drop in relative reactivity, while none of the bp substitutions at pb position 1 has a significant effect
-
-
-
additional information
?
-
-
the AAGU hairpin binds to and is efficiently cleaved by Rnt1p in the context of the snR47 stem sequence
-
-
-
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA in mammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as a mechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
-
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA inmammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as amechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
-
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
-
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
-
additional information
?
-
-
processing of dsRNA
-
-
-
additional information
?
-
P9WH03
processing of dsRNA
-
-
-
additional information
?
-
-
processing of dsRNA, specific bp sequence elements can modulate substrate reactivity, and a network of hydrogen bonds provides an energetically important contribution to Rnt1p binding, a phylogenetic-based substrate alignment analysis reveals a statistically significant exclusion of the UA bp from the position adjacent to the tetraloop. Rnt1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways. The enzyme also interacts with Gar1p, a protein involved in pseudouridylation reactions, via its C-terminal portion adjacent to the dsRBD
-
-
-
additional information
?
-
A8BQJ3
processing of dsRNA, the PAZ domain specifically recognizes the 2-nt, 3'-overhangs of a processed dsRNA terminus
-
-
-
additional information
?
-
-
processing of dsRNA. Drosha acts on primary transcripts synthesized by RNA polymerase II that typically contain several miRNAs. Site-specific cleavage within irregular, extended hairpin structures (pri-miRNAs) creates the pre-miRNAs that then are delivered by Exportin5 to the cytoplasm for final maturation by Dicer. Drosha functions within a complex termed the microprocessor that contains a protein, DGCR8, that is required for Drosha action
-
-
-
additional information
?
-
-
processing of dsRNA. Pac1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways
-
-
-
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
-
additional information
?
-
-
RNase III specifically processes the proU mRNA within a conserved secondary structure extending from position +203 to +293 of the transcript
-
-
-
additional information
?
-
-
the class 1 enzyme binds and processes small dsRNA molecules, it can cleave long dsRNA molecules, synthetic small interfering RNAs (siRNAs), and plant- and virus-derived siRNAs extracted from sweet potato plants
-
-
-
additional information
?
-
-
the enzyme cleaves the proU operon transcript reducing its half-life from 65 sec to 4 sec, the rapid degradation ensures efficient inhibition of proU expression and further uptake of osmoprotectants. Processing of dsRNA, product release is the rate-limiting step in the catalytic pathway
-
-
-
additional information
?
-
-
the enzyme interacts with membrane lipids
-
-
-
additional information
?
-
-
the enzyme processes betT and proU mRNA
-
-
-
additional information
?
-
-
the enzyme processes ribosomal RNA
-
-
-
additional information
?
-
-
the enzyme processes ribosomal RNA, small nucleolar RNA, small nuclear RNA, and messenger RNA
-
-
-
additional information
?
-
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
-
additional information
?
-
A8BQJ3
Dicer substrate recognition and specificity, overview
-
-
-
additional information
?
-
-
Drosha cleavage site analysis, reactivity determinants of a pri-miRNA substrate for Drosha, and a proposed DGCR8-dsRNA interaction, and Dicer substrate recognition and specificity, overview
-
-
-
additional information
?
-
-
enzyme assay with commercial yeast tRNA
-
-
-
additional information
?
-
-
mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
-
additional information
?
-
-
the enzyme cleaves betT and proU mRNA. Introdution of nucleotide substitutions C33U and C39U in thhe enzymes' cleavage sites of betT mRNA inhibit the enzyme activity
-
-
-
additional information
?
-
-
the enzyme cleaves ds-siRNAs and microRNAs (miRNAs) with a regular A-form conformation, while asymmetrical bulges, extensive mismatches and 2'-O-methylation of ds-siRNA and miRNA interfer with processing, substrate specifiicty of the enzyme in processing small RNA duplexes, overview
-
-
-
additional information
?
-
B1XB41
the enzyme is active with DAPI-enriched pre-rRNA fragments
-
-
-
additional information
?
-
-
txpA and RatA form an extended hybrid that is a substrate for RNase III cleavage
-
-
-
additional information
?
-
Streptococcus pyogenes SF370
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
-
additional information
?
-
Mycobacterium tuberculosis ATCC 35618
P9WH03
processing of dsRNA
-
-
-
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
-
additional information
?
-
Saccharomyces cerevisiae ATCC 204508
Q02555
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop, mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
-
additional information
?
-
Staphylococcus aureus RN6390
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
-
additional information
?
-
Escherichia coli K12
P0A7Y0
as a binding protein, RNase III binds and stabilizes certain RNAs, thus suppressing the expression of certain genes
-
-
-
additional information
?
-
Streptomyces coelicolor M145
Q9ZBQ7
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
-
additional information
?
-
Escherichia coli MG1655rnc
-
the enzyme processes betT and proU mRNA, the enzyme cleaves betT and proU mRNA. Introdution of nucleotide substitutions C33U and C39U in thhe enzymes' cleavage sites of betT mRNA inhibit the enzyme activity
-
-
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
25S pre-rRNA + H2O
25S rRNA
show the reaction diagram
-
processing
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
dsRNA-specific endonuclease activity enhances the RNA-silencing suppression activity of another protein (p22) encoded by SPCSV. RNase3 and p22 coexpression reduce siRNA accumulation more efficiently than p22 alone in Nicotiana benthamiana leaves expressing a strong silencing inducer (i.e., dsRNA). RNase3 does not cause intracellular silencing suppression or reduce accumulation of siRNA in the absence of p22 or enhance silencing suppression activity of a protein encoded by a heterologous virus
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
the enzyme is able to process rRNAs and to regulate the levels of polynucleotide phosphorylase
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
enzyme plays multiple roles in the processing of rRNA and mRNA and strongly affects the decay of the sRNA MicA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, preferred substrate contains NGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
involved in the production of short interfering RNAs (siRNAs) and for the processing of precursor miRNAs (pre-miRNAs) into microRNAs (miRNAs)
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Q8R418
processing of precursor dsRNAs into mature microRNAs and small-interfering RNAs
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for processing and maturation of RNA precursors into functional rRNA, mRNA and other small RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for processing of dsRNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
P0A7Y0
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
-
responsible for the production of short interfering RNAs and microRNAs that induce gene silencing known as RNA interference
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
show the reaction diagram
Escherichia coli K12
P0A7Y0
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
ds-rRNA + H2O
mature ds-rRNA
show the reaction diagram
-
-
-
-
?
dsRNA + H2O
?
show the reaction diagram
-
cleavage to short RNA pieces
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
enzyme is involved in the maturation and decay of cellular, phage and plasmid RNAs
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
enzyme plays a key role in diverse maturation and degradation processes
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
obligatory step in the maturation and decay of diverse RNAs
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
reshaping of fully or partially double-stranded RNA precursors in to mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
show the reaction diagram
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
pre-16S rRNA + H2O
mature 16S rRNA
show the reaction diagram
-
-
-
-
?
pre-23S rRNA + H2O
mature 23S rRNA
show the reaction diagram
-
-
-
-
?
pre-5S rRNA + H2O
mature 5S rRNA
show the reaction diagram
-
-
-
-
?
pre-mRNA + H2O
mature mRNA
show the reaction diagram
-
enzyme regulates gene expression by controlling mRNA translation and stability
-
-
?
pre-rRNA + H2O
mature rRNA
show the reaction diagram
-
-
-
-
?
pre-rRNA + H2O
mature rRNA
show the reaction diagram
-
enzyme is required for processing
-
-
?
pre-snoRNA + H2O
mature snoRNA
show the reaction diagram
-
enzyme is required for processing
-
-
?
pre-snRNA + H2O
mature snRNA
show the reaction diagram
-
enzyme is required for processing
-
-
?
dsRNA + H2O
processed RNA
show the reaction diagram
-
-
-
-
?
additional information
?
-
-
enzyme is essential, and is involved in RNA interference, i.e. RNAi, a post-transcriptional gene-silencing phenomenon, and germ line development
-
-
-
additional information
?
-
-
enzyme is involved in RNA processing and RNA interference, i.e. RNAi, regulation by a combination of primary and tertiary structural elements allowing a substrate-specific binding and cleavage efficiency
-
-
-
additional information
?
-
-
involved in the maturation of the ribosomal RNA precursor, and bacteriophage T7 mRNA precursors, enzyme participates in the degradation as well as maturation of diverse cellular, phage, and plasmid RNAs
-
-
-
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
phylogenetic analysis, enzyme might be important for virus replication
-
-
-
additional information
?
-
-
RNAIII and the endoribonuclease III coordinately regulate spa gene expression
-
-
-
additional information
?
-
Q02555
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
-
additional information
?
-
P0A7Y0
as a binding protein, RNase III binds and stabilizes certain RNAs, thus suppressing the expression of certain genes
-
-
-
additional information
?
-
-
required for 3external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo
-
-
-
additional information
?
-
-
ability of Dicer C-terminus to interact with 5-lipoxygenase
-
-
-
additional information
?
-
-
Dicer functions as a dsRNA-processing enzyme, producing small interfering RNA (siRNA). Dicer plays important roles in RNA processing, posttranscriptional gene expression control, and defense against virus infection. Bacterial RNase III functions not only as a processing enzyme, but also as a binding protein that binds dsRNA without cleaving it
-
-
-
additional information
?
-
Q9ZBQ7
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
-
additional information
?
-
O31418
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
-
additional information
?
-
Q9ZBQ7
Streptomyces coelicolor absB gene encodes an RNase III family endoribonuclease and is essential for antibiotic biosynthesis. AbsB controls its own expression by sequentially and site specifically cleaving stem-loop segments of its polycistronic transcript
-
-
-
additional information
?
-
-
the gene encoding RNase III in Streptomyces coelicolor is transcribed during exponential phase and is required for antibiotic production and for proper sporulation
-
-
-
additional information
?
-
-
Dicer-1 and Dicer-2 show different substrate specificity in vivo: Dicer-2 generates small interfering RNAs, siRNAs, from long double-stranded RNA, dsRNA, whereas Dicer-1 produces microRNAs, miRNAs, from pre-miRNA. Dicer-2 can efficiently cleave pre-miRNA in vitro, but phosphate and the Dicer-2 partner protein R2D2 inhibit pre-miRNA cleavage in vivo. Wild-type Dicer-2, but not a mutant defective in ATP hydrolysis, can generate siRNAs faster than it can dissociate from a long dsRNA substrate. Dicer-1 does not efficiently process long dsRNA
-
-
-
additional information
?
-
-
endonuclease mRPN1 directly binds with TbRGG2 and exhibits a nuclease-resistant association with two more proteins, 4160 and 8170, it might modulate gRNA utilization by editing complexes
-
-
-
additional information
?
-
-
in vitro RNase III is active with MicA when it is in complex with its targets, ompA or lamB mRNAs. MicA is cleaved by RNase III in a coupled way with ompA mRNA
-
-
-
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
-
additional information
?
-
-
Rnt1p, the major RNase III in Saccharomyces cerevisiae, cleaves RNA substrates containing hairpins capped by A/uGNN tetraloops, using its double-stranded RNA binding domains, dsRBD, to recognize a conserved tetraloop fold. The dsRBD adopts the same conformation in both the AAGU and AGAA complexes
-
-
-
additional information
?
-
-
small hairpins based on the stem structures associated with the Aquifex 16S and 23S rRNA precursors are cleaved at sites that are consistent with production of the immediate precursors to the mature rRNAs. Substrate reactivity is independent of the distal box sequence, but is strongly dependent on the proximal box sequence. RNase III mechanism of dsRNA cleavage, overview
-
-
-
additional information
?
-
-
two-step cleavage of hairpin RNA with 5' overhangs
-
-
-
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA in mammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as a mechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
-
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA inmammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as amechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
-
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
-
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
-
additional information
?
-
-
processing of dsRNA
-
-
-
additional information
?
-
P9WH03
processing of dsRNA
-
-
-
additional information
?
-
-
processing of dsRNA, specific bp sequence elements can modulate substrate reactivity, and a network of hydrogen bonds provides an energetically important contribution to Rnt1p binding, a phylogenetic-based substrate alignment analysis reveals a statistically significant exclusion of the UA bp from the position adjacent to the tetraloop. Rnt1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways. The enzyme also interacts with Gar1p, a protein involved in pseudouridylation reactions, via its C-terminal portion adjacent to the dsRBD
-
-
-
additional information
?
-
A8BQJ3
processing of dsRNA, the PAZ domain specifically recognizes the 2-nt, 3'-overhangs of a processed dsRNA terminus
-
-
-
additional information
?
-
-
processing of dsRNA. Drosha acts on primary transcripts synthesized by RNA polymerase II that typically contain several miRNAs. Site-specific cleavage within irregular, extended hairpin structures (pri-miRNAs) creates the pre-miRNAs that then are delivered by Exportin5 to the cytoplasm for final maturation by Dicer. Drosha functions within a complex termed the microprocessor that contains a protein, DGCR8, that is required for Drosha action
-
-
-
additional information
?
-
-
processing of dsRNA. Pac1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways
-
-
-
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
-
additional information
?
-
-
RNase III specifically processes the proU mRNA within a conserved secondary structure extending from position +203 to +293 of the transcript
-
-
-
additional information
?
-
-
the class 1 enzyme binds and processes small dsRNA molecules, it can cleave long dsRNA molecules, synthetic small interfering RNAs (siRNAs), and plant- and virus-derived siRNAs extracted from sweet potato plants
-
-
-
additional information
?
-
-
the enzyme cleaves the proU operon transcript reducing its half-life from 65 sec to 4 sec, the rapid degradation ensures efficient inhibition of proU expression and further uptake of osmoprotectants. Processing of dsRNA, product release is the rate-limiting step in the catalytic pathway
-
-
-
additional information
?
-
-
the enzyme interacts with membrane lipids
-
-
-
additional information
?
-
-
the enzyme processes betT and proU mRNA
-
-
-
additional information
?
-
-
the enzyme processes ribosomal RNA
-
-
-
additional information
?
-
-
the enzyme processes ribosomal RNA, small nucleolar RNA, small nuclear RNA, and messenger RNA
-
-
-
additional information
?
-
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
-
additional information
?
-
Streptococcus pyogenes SF370
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
-
additional information
?
-
Mycobacterium tuberculosis ATCC 35618
P9WH03
processing of dsRNA
-
-
-
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
-
additional information
?
-
Saccharomyces cerevisiae ATCC 204508
Q02555
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
-
additional information
?
-
Staphylococcus aureus RN6390
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
-
additional information
?
-
Escherichia coli K12
P0A7Y0
as a binding protein, RNase III binds and stabilizes certain RNAs, thus suppressing the expression of certain genes
-
-
-
additional information
?
-
Streptomyces coelicolor M145
Q9ZBQ7
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
-
additional information
?
-
Escherichia coli MG1655rnc
-
the enzyme processes betT and proU mRNA
-
-
-
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
Ca2+
P0A7Y0
inactive
Co2+
-
inhibits
Co2+
-
stimulates
Co2+
-
stimulates
Co2+
-
can partially substitute for Mg2+ or Mn2+
Co2+
-
can partially substitute for Mg2+
Co2+
P0A7Y0
can substitute for Mg2+
Co2+
-
less effective than Mg2+
Co2+
A8BQJ3
activates
Co2+
-
activates
Co2+
P9WH03
activates
K+
-
stimulates, maximum activity at 0.15-0.3 M
K+
-
maximum activity at 0.1 -0.15 M
K+
-
stimulation at 20 mM
KCl
-
substrate affinity is enhanced under low-salt (10 mM KCl) conditions
KCl
-
activates at 50 mM, inhibits at concentrations above 100 mM
Mg2+
-
different cleavage pattern depending on the cation used
Mg2+
-
required
Mg2+
-
higher requirement in G97E mtuants
Mg2+
-
stimulates
Mg2+
-
dependent on, optimal at 25 mM
Mg2+
-
activity with recombinant hybrid enzyme mutants, overview
Mg2+
-
dependent on
Mg2+
Paramecium bursaria Chlorella virus-1
-
dependent on, optimum concentration is about 5 mM
Mg2+
-
required, K(Mg2+): 0.46 mM for wild-type enzyme, 1.58 mM for mutant enzyme E38A, 1.25 mM for mutant enzyme E41A, 1.27 mM for mutant enzyme E65A, 2.48 mM for mutant enzyme E100A, 1.35 mM for mutant enzyme D114A, 39 mM for mutant enzyme E41A/D114A
Mg2+
-
divalent metal required, Mg2+ is the preffered species, evidennce for involvement of two Mg2+ ions in phosphodiester hydrolysis
Mg2+
-
; required
Mg2+
P0A7Y0
; required
Mg2+
Q9NRR4
;
Mg2+
-
two ions bound around the active site, one of which is involved in the catalytic mechanism and the second in RNA substrate binding
Mg2+
-
two Mg2+ ions are required for the cleavage of each phosphodiester bond
Mg2+
Q5YF04
dsRNA substrate is cleaved by the RBIV RNase III at high concentrations of Mg2+ (5-20 mM) and at low salt concentration (50 mM)
Mg2+
-
-
Mg2+
-
recombinant Sa-RNase III requires MgCl2 for activity
Mg2+
-
activates optimally at 1 mM
Mg2+
-
required, Mg2+ and Mn2+ both support the catalytic reaction
Mg2+
-
required
Mg2+
-
Mg2+ best supports the catalytic activity of enzyme RNase3
Mg2+
-
required
Mg2+
A8BQJ3
activates
Mg2+
-
activates
Mg2+
P9WH03
activates
Mn2+
-
different cleavage pattern depending on the cation used
Mn2+
-
inhibits
Mn2+
-
optimal concentration at 0.15-0.3 mM; stimulates
Mn2+
-
stimulates
Mn2+
-
can substitute for Mg2+, showing slightly higher activity with the wild-type enzyme, highly activates the mutant E117D, no activity with mutant E117Q
Mn2+
-
can substitute for Mg2+ in vitro, at 5 mM
Mn2+
-
activity with recombinant hybrid enzyme mutants, overview
Mn2+
-
can partially substitute for Mg2+
Mn2+
Paramecium bursaria Chlorella virus-1
-
can substitute for Mg2+, best at 1 mM, leads to production of additional cleavage products
Mn2+
-
divalent metal required, Mn2+ can replace Mg2+ in activation
Mn2+
P0A7Y0
can substitute for Mg2+
Mn2+
Q5YF04
substrate dsRNA is cleaved at low concentrations of Mn2+ (0.5-1 mM) at low salt concentration (50 mM) and is cleaved by increasing Mn2+ (5-20 mM) at 200 mM salt
Mn2+
-
-
Mn2+
-
less effective than Mg2+
Mn2+
-
required, Mg2+ and Mn2+ both support the catalytic reaction
Mn2+
-
less efficient in activation of the enzyme compared to Mg2+, but binding of 21 nt small dsRNA molecules is most efficient in the presence of Mn2+
Mn2+
A8BQJ3
activates
Mn2+
-
activates
Mn2+
P9WH03
activates
Na+
-
stimulates, maximum activity at 0.15-0.3 M
Na+
-
required
Na+
-
stimualtion at 20 mM
NaCl
-
activates at 50 mM, inhibits at concentrations above 100 mM
NH4Cl
-
activates at 50 mM, inhibits at concentrations above 100 mM
Ni2+
-
can partially substitute for Mg2+ or Mn2+
Ni2+
-
can partially substitute for Mg2+
Ni2+
P0A7Y0
can substitute for Mg2+
Ni2+
-
less effective than Mg2+
Ni2+
A8BQJ3
activates
Ni2+
-
activates
Ni2+
P9WH03
activates
Sr2+
P0A7Y0
inactive
Zn2+
-
inhibits Mg2+ dependent reaction
Zn2+
P0A7Y0
inactive
Zn2+
-
less efficient in activation of the enzyme compared to Mg2+
additional information
-
no activity of mutant E117Q with Ca2+, Ni2+, Co2+, or Sr2+
additional information
-
metal ion specificity of the enzyme is determined by the N-terminus
additional information
-
no activity with Ca2+ and Sr2+
additional information
-
the enzyme functions optimally at pH 8 and about 50-80 mM salt concentrations
additional information
-
no activation by Ni2+, Co2+, and Ca2+
additional information
-
recombinant mRPN1 requires Mg2+ and a critical catalytic carboxylate
additional information
-
no activation of the enzyme by Ca2+
additional information
-
no activation by Ca2+. The enzyme requires a divalent metal ion for catalysis, catalysis appears to be largely driven by the two metals. The adjacency of the two metal ions and their interaction with the scissile phosphodiester linkage fit the well-studied two-metal-ion catalytic mechanism, wherein one metal binds and activates the water nucleophile, and the second metal facilitates departure of the 3'-oxygen atom. Both metal ions are jointly coordinated to the side chain of a highly conserved, functionally essential glutamic acid E110
additional information
-
no activation by Ca2+. The enzyme requires a divalent metal ion for catalysis, catalysis appears to be largely driven by the two metals. The adjacency of the two metal ions and their interaction with the scissile phosphodiester linkage fit the well-studied two-metal-ion catalytic mechanism, wherein one metal binds and activates the water nucleophile, and the second metal facilitates departure of the 3'-oxygen atom. Both metal ions are jointly coordinated to the side chain of a highly conserved, functionally essential glutamic acid E117
additional information
A8BQJ3
the enzyme requires a divalent metal ion for catalysis
additional information
-
the enzyme requires a divalent metal ion for catalysis
additional information
P9WH03
the enzyme requires a divalent metal ion for catalysis
additional information
-
the enzyme requires a divalent metal ion for catalysis
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
2-hydroxyisoquinoline-1,3-dione
-
inhibits cleavage of R1.1 RNA, IC50: 0.014 mM for Mg2+-supported reaction, 0.008 mM for Mn2+-suppoeted reaction, noncompetitive inhibition
2-mercaptoethanol
-
required
Ca2+
-
recombinant Sa-RNase III is inhibited by Ca2+
Double-stranded RNA
-
inhibits cleavage of single-stranded RNA
-
Double-stranded RNA
-
inhibits cleavage of single-stranded RNA
-
EDTA
-
-
EDTA
-
greater than 10 mM
EDTA
Paramecium bursaria Chlorella virus-1
-
-
Ethidium bromide
-
at 1.5 M
Ethidium bromide
-
-
Ethidium bromide
-
-
Ethidium bromide
-
inhibition of wild-type and deletion mutant, intercalative mode of inhibition, competitive, 50% inhibition at 0.01 mM
Ethidium bromide
-
reversible, competitive inhibition in vitro, uncouples small RNA substrate binding and cleavage, intercalation inhibition mechanism, perturbation of substrate recognition by the N-terminal catalytic domain, 81% inhibition at 0.02 mM, tRNA abolishes the inhibitory effect
F-
-
inhibits at 100 mM
inhibitory base pair sequences within a RNA substrate
-
inclusion of disfavored base pair sequences inhibit activity
-
K+
-
inhibits at 0.14 M
K+
-
inhibits at concentrations higher than 200 mM
KCl
-
enzyme is sensitive to high salt conditions, above 50 mM, the mutant homodimer and the heterodimer are more sensitive than the wild-type
KCl
-
activates at 50 mM, inhibits at concentrations above 100 mM
Mn2+
-
at concentrations higher than 0.5 mM
Mn2+
-
at concentrations above 5 mM, mutant E117D is not inhibited, inhibition of the wild-type enzyme by excess Mn2+ cannot be relieved by high concentrations of Mg2+, inhibition mechanism
NaCl
-
inhibits at 0.14 M
NaCl
-
0.15-0.3 M cleaves at primary cleavage sites, inhibition at higher concentrations, at 5 mM additional secondary cleavage sites
NaCl
Q5YF04
completely inhibited at 200 mM NaCl (within physiological ranges) irrespective of Mg2+ concentrations (0.5-20 mM)
NaCl
-
activates at 50 mM, inhibits at concentrations above 100 mM
NH4+
-
inhibits at 0.14 M
NH4+
-
concentration dependent cleavage pattern
NH4+
-
inhibits at concentrations higher than 200 mM
NH4Cl
-
activates at 50 mM, inhibits at concentrations above 100 mM
Nucleic acids
-
-
-
phosphate
-
inhibits Dicer-2
poly(IC)
-
as double-stranded RNA
-
protein R2D2
-
Dicer-2 partner protein R2D2 inhibit pre-miRNA cleavage in vivo by Dicer-2, but activates dsRNA cleavage of Dicer-2
-
tRNA
-
inhibits enzyme activity and inhibition by ethidium bromide
YmdB
-
stress-responsive ribonuclease-binding regulator of Escherichia coli RNase III activity. Interacting with a site in the RNase III catalytic region. Expression of YmdB is transcriptionally activated by both cold-shock stress and the entry of cells into stationary phase, and that this activation requires the delta-factor-encoding gene, rpoS
-
Zn2+
-
inhibits Mg2+ dependent reaction
Mn2+
-
inhibition of wild-type and deletion mutant at high concentration due to metal ion occupancy at an inhibitory site of the enzyme, the deletion mutant is less sensitive than the wild-type enzyme
additional information
-
no inhibition by high concentrations of Mg2+
-
additional information
-
enzyme is inhibited by Watson-Crick bp antideterminants, overview
-
additional information
-
substrate binding is inhibited by a specific sequence within the dsRNA stem, overview
-
additional information
-
the RNA substrate bulge-helix-bulge motif acts as a catalytic antideterminant, leading to uncoupling of substrate recognition and cleavage, not to inhibition of substrate binding
-
additional information
-
enzyme activity is inhibited at high osmolarity
-
additional information
-
the RNase III activity in vivo is responsive to osmotic stress
-
ACTIVATING COMPOUND
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
ATP
-
ATP hydrolysis is required for Dicer-2 to process long dsRNA, but not pre-miRNA
dsRNA
-
activates Dicer-2
-
EDTA
-
less than 1 mM
glutamate
-
extends salt concentration range
lamB RNA
-
MicA cleavage by RNase III is facilitated by base pairing with MicA mRNA target(s)
-
NH4+
-
maximum activity at 0.15-0.3 M
NH4+
-
-
NH4+
-
maximum activity at 0.1 -0.15 M
NH4+
-
cleavage pattern depends on concentration
NH4+
-
required
NH4+
-
stimualtion at 20 mM
ompA RNA
-
MicA cleavage by RNase III is facilitated by base pairing with MicA mRNA target(s)
-
protein R2D2
-
Dicer-2 partner protein R2D2 inhibit pre-miRNA cleavage in vivo by Dicer-2, but activates dsRNA cleavage of Dicer-2
-
Loquacious-PB
-
activates dsRNA cleavage of Dicer-2
-
additional information
-
silencing of the drosha cofactor, pasha, leads to developmental complications and consequent lethality
-
additional information
-
enzyme activity is increased at low osmolarity
-
additional information
-
T7-induced catalytic enhancement of the enzyme
-
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.0000004
515 bp dsRNA
-
wild-type Dicer-2 in presence of Loquacious-PB at equimolar level, pH 7.4, 25C
-
0.000002
515 bp dsRNA
-
wild-type Dicer-2 in presence of protein R2D2 at equimolar level, pH 7.4, 25C
-
0.000006
515 bp dsRNA
-
wild-type Dicer-2, pH 7.4, 25C
-
0.00098
Aa-[16S[micro-hp]RNA]
-
pH 8.0, 40C
-
0.000041
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E41A
-
0.000054
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E38A
-
0.000056
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E65A
-
0.000066
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, wild-type enzyme
-
0.000071
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme D114A
-
0.00011
R1.1 RNA
-
wild-type enzyme, pH 7.5, 37C, in presence of Mn2+
-
0.00011
R1.1 RNA
-
recombinant wild-type enzyme, 37C, in presence of 1 mM Mn2+
-
0.00027
R1.1 RNA
-
recombinant enzyme mutant RNase III[DELTAdsRBD], 37C, in presence of 5 mM Mn2+
-
0.00034
R1.1 RNA
-
wild-type enzyme, pH 7.5, 37C, in presence of Mg2+
-
0.00034
R1.1 RNA
-
recombinant wild-type enzyme, 37C, in presence of 5 mM Mg2+
-
0.000544
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E100A
-
0.00064
R1.1 RNA
-
mutant E117D, pH 7.5, 37C, in presence of Mn2+
-
0.003
R1.1 RNA
-
recombinant enzyme mutant RNase III[DELTAdsRBD], 37C, in presence of 25 mM Mg2+
-
0.00026
RNA
-
-
0.26
RNA
-
37C
0.34
RNA
-
recombinant His-tagged enzyme, pH 8.0, 35C
38
Mn2+
-
mutant E117D, pH 7.5, 37C
additional information
additional information
-
catalytic and substrate binding kinetics
-
additional information
additional information
-
kinetics
-
additional information
additional information
-
kinetics, substrate binding with diverse RNA substrates
-
additional information
additional information
-
substrate binding kinetics, wild-type and mutant enzyme, in presence or absence of ethidium bromide
-
additional information
additional information
-
Michaelis-Menten Analysis of Dicer-2 Incubated with a 515 bp dsRNA and ATP, overview
-
additional information
additional information
-
Michaelis-Menten kinetics
-
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.0005
515 bp dsRNA
-
wild-type Dicer-2 in presence of Loquacious-PB at equimolar level, pH 7.4, 25C; wild-type Dicer-2 in presence of protein R2D2 at equimolar level, pH 7.4, 25C; wild-type Dicer-2, pH 7.4, 25C
-
0.00035
R1.1 RNA
-
mutant E117D, pH 7.5, 37C, in presence of Mn2+
-
0.023
R1.1 RNA
-
wild-type enzyme, pH 7.5, 37C, in presence of Mn2+
-
0.023
R1.1 RNA
-
recombinant wild-type enzyme, 37C, in presence of 1 mM Mn2+
-
0.032
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E41A
-
0.048
R1.1 RNA
-
recombinant enzyme mutant RNase III[DELTAdsRBD], 37C, in presence of 5 mM Mn2+
-
0.052
R1.1 RNA
-
recombinant enzyme mutant RNase III[DELTAdsRBD], 37C, in presence of 25 mM Mg2+
-
0.063
R1.1 RNA
-
wild-type enzyme, pH 7.5, 37C, in presence of Mg2+
-
0.063
R1.1 RNA
-
recombinant wild-type enzyme, 37C, in presence of 5 mM Mg2+
-
0.09
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E38A
-
0.098
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E65A
-
0.14
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, wild-type enzyme
-
0.165
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme D114A
-
0.72
R1.1 RNA
-
pH 7.5, 37C, buffer containing 10 mM Mg2+, mutant enzyme E100A
-
3.8
RNA
-
recombinant His-tagged enzyme, pH 8.0, 35C
7.7
RNA
-
37C
0.045
Aa-[16S[micro-hp]RNA]
-
pH 8.0, 40C
-
additional information
additional information
-
Rnt1p cleavage of bipartite substrates: 0.087 1/s for EL11:TL as a substrate, 0.248 1/s for EL18-EM:TL as a substrate, 0.55 1/s for EL11-EM:TL as a substrate, 0.302 1/s for EL11-EM+1:TL as a substrate, 0.4 1/s for EL11-5'3'M:TL as a substrate, 0.55 1/s for EL11-dT:TL as a substrate, 0.028 1/s for EL11-ES:TL as a substrate, 0.042 1/s for EL11-5'stemM:TL as a substrate, 0.03 1/s for EL11-A6M:TL as a substrate. Rnt1p cleavage of 2'-fluoro-modified substrate: 0.07 1/s for EL11:TL as a substrate, 0.0283 1/s for EL11-A6F:TL as a substrate, 0.026 1/s for EL11-G7F:TL as a substrate, 0.016 1/s for EL11-C10F:TL as a substrate, 0.026 1/s for EL11-AAGU:TL as a substrate, 0.0115 1/s for EL11-AAGU-A6F:TL as a substrate, 0.013 1/s for EL11-AAGU-A7F:TL as a substrate, 0.0078 1/s for EL11-AAGU-C10F:TL as a substrate, 0.0183 1/s for EL11:TL as a substrate. DELTAN-term cleavage of 2'-fluoro-modified substrate: 0.022 1/s for EL11-A6F:TL as a substrate, 0.012 1/s for EL11-G7F:TL as a substrate, 0.012 1/s for EL11-C10F:TL as a substrate, 0.01 1/s for EL11-AAGU:TL as a substrate, 0.0085 1/s for EL11-AAGU-A6F:TL as a substrate, 0.0073 1/s for EL11-AAGU-A7F:TL as a substrate, 0.00783 1/s for EL11-AAGU-C10F:TL as a substrate
-
kcat/KM VALUE [1/mMs-1]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.083
515 bp dsRNA
-
wild-type Dicer-2, pH 7.4, 25C
0
0.33
515 bp dsRNA
-
wild-type Dicer-2 in presence of protein R2D2 at equimolar level, pH 7.4, 25C
0
1.33
515 bp dsRNA
-
wild-type Dicer-2 in presence of Loquacious-PB at equimolar level, pH 7.4, 25C
0
466.7
Aa-[16S[micro-hp]RNA]
-
pH 8.0, 40C
0
Ki VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.0017
Ethidium bromide
-
pH 8.0, 37C
IC50 VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.014
2-hydroxyisoquinoline-1,3-dione
-
inhibits cleavage of R1.1 RNA, IC50: 0.014 mM for Mg2+-supported reaction, 0.008 mM for Mn2+-suppoeted reaction, noncompetitive inhibition
SPECIFIC ACTIVITY [µmol/min/mg]
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
additional information
-
gel mobility shift assay for substrate bindng determination
pH OPTIMUM
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
6.8 - 8.2
-
-
7 - 7.4
-
inactive below, RNA
7.4
-
assay at
7.5 - 8.5
-
processing of long dsRNA by RNase3 is efficient at pH 7.5-8.5, ds-siRNA is processed more efficiently at pH 8.5
7.5
A6YSL1
endonuclease assay
8 - 9
-
broad maximum
9
-
assay at
pH RANGE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
6.5 - 9
-
and above, activity range
6.9 - 7.4
-
-
7.6 - 9.75
-
-
8 - 10
-
RNA
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
25
A6YSL1
endonuclease assay
35
-
assay at
37
-
assay at
37
-
assay at
37
-
assay at
37
-
assay at
40 - 70
-
RNase III catalytic activity exhibits a broad optimal temperature range
70 - 85
-
-
TEMPERATURE RANGE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
30 - 37
-
-
30 - 45
-
no activity at 0C and 17.5C
40 - 85
-
and above, activity range
40 - 95
-
activity range
additional information
-
samples of bacterial cultures are grown in LB medium at 28C or 37C
SOURCE TISSUE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
SOURCE
A6YSL1
-
Manually annotated by BRENDA team
Streptomyces antibioticus IMRU 3720
-
-
-
Manually annotated by BRENDA team
-
AtRTL1 and AtRTL2
Manually annotated by BRENDA team
-
dry and germinating, AtRTL2
Manually annotated by BRENDA team
additional information
Paramecium bursaria Chlorella virus-1
-
enzyme is expressed during the very early infection stage of the virus, 5 min p.i., and disappears 20 min p.i.
Manually annotated by BRENDA team
additional information
-
HvAV-3e-infected HzFB cells
Manually annotated by BRENDA team
additional information
-
the activity of Drosha is modulated between different cell types or differentiation stages
Manually annotated by BRENDA team
LOCALIZATION
ORGANISM
UNIPROT
COMMENTARY
GeneOntology No.
LITERATURE
SOURCE
-
no ribosomal enzyme
-
Manually annotated by BRENDA team
-
phosphorylation at Ser300 or Ser302 locates Drosha to the nucleus. Nuclear localization of Drosha is critical for its functionality in miRNA processing
Manually annotated by BRENDA team
PDB
SCOP
CATH
ORGANISM
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Aquifex aeolicus (strain VF5)
Campylobacter jejuni subsp. jejuni (strain IA3902)
Campylobacter jejuni subsp. jejuni serotype O:2 (strain NCTC 11168)
Escherichia coli (strain K12)
Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099)
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
27900
-
homodimer of 243 amino acid polypeptides
694010
30900
Q5YF04
calculated from sequence
690653
31090
Q5YF04
of the His-tag fused protein, SDS-PAGE
690653
38100
O31418
gel filtration
694226
40000 - 55000
-
sucrose density gradient centrifugation, gel filtration
134343, 134348
40000 - 55000
-
-
134349, 134352
41000
-
RNase O, gel filtration
134346
44000
-
gel filtration, SDS-PAGE
134350
50000 - 60000
-
gel filtration
134344
54000
-
recombinant His-tagged mutant homodimer, gel filtration
655555
56000
P0A9J0
SDS-PAGE
706976
57300
-
purified recombinant His-tagged wild-type enzyme, gel filtration
716905
64000
Paramecium bursaria Chlorella virus-1
-
recombinant, non-tagged enzyme, native PAGE
657401
78000
-
recombinant His-tagged and GST-tagged wild-type/mutant heterodimer, gel filtration
655555
103000
-
recombinant GST-tagged wild-type homodimer, gel filtration
655555
110000
-
recombinant wild-type enzyme, gel filtration
657333
110000
-
gel filtration
682190
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
?
-
x * 25600, amino acid sequence calculation, x * 29000, recombinant His-tagged enzyme, SDS-PAGE
?
-
x * 108000, calculated from the deduced amino acid sequence for AtRTL3, x * 33000, calculated from the deduced amino acid sequence for AtRTL1
dimer
-
-
dimer
-
2 * 20000-25000, SDS-PAGE
dimer
-
2 * 25000-25300, SDS-PAGE
dimer
-
2 * 25600, wild-type enzyme, SDS-PAGE
dimer
-
2 * 29000, about, recombinant His-tagged enzymes, SDS-PAGE
dimer
Paramecium bursaria Chlorella virus-1
-
2 * 31000, recombinant enzyme, intein tag is cleaved off
dimer
-
2 * 55000, amino acid sequence calculation
dimer
-
2 * 45000, subunit mass calculated from the deduced amino acid sequence for AtRTL2, native mass by gel filtration, forms highly salt resistant dimers, dimer formation through disulfide bonds, dimers can be disrupted upon DTT treatment
dimer
-
recombinant RNase IIIb-dsRBD fragment, crystal structure analysis, and gel filtration data
dimer
Q8R418
the RNase IIIb + dsRBD construct exists as a symmetric homodimer, crystal structure analysis and gel filtration, dimer is catalytically active
dimer
O31418
2 * 17100, His-tagged monomer, calculated
dimer
-
homology model of mRPN1, overview
dimer
Escherichia coli K12
-
-
-
heterodimer
-
-
heterodimer
-
preparation of artificial heterodimers of RNase III, which are providing new insight on the subunit and domain interactions involved in dsRNA recognition and cleavage
homodimer
-
-
homodimer
P9WH03
-
homodimer
-
the Drosha polypeptide possesses tandem RNase III domains and a C-terminal dsRBD. The RNase III domains form an intramolecular pseudodimer with two catalytic sites. The Drosha dsRBD structure shows an alpha1-alpha1 loop element with a dynamic, extended structure
homodimer
A8BQJ3
the minimal Dicer of Giardia intestinalis contains the PAZ and tandem RNase III domains, pseudodimeric RNase III domain
homodimer
Mycobacterium tuberculosis ATCC 35618
-
-
-
monomer
-
biochemical experiments indicate that Drosha functions as a monomer, with its ribonuclease domains forming an internal dimer structure
additional information
-
deletion mutant RNT1DELTA2-198 also behaves as a dimer
additional information
-
enzyme contains the conserved dsRNA binding and nuclease domains, the dsRBD self-interacts with the N-terminal domain to stabilize the enzyme homodimer
additional information
-
model of class I endonuclease domain dimer
additional information
-
model of class III endonuclease domain dimer
additional information
-
the enzyme consists of a catalytic and a substrate binding domain
additional information
-
the enzyme contains a conserved dsRNA-binding and a conserved catalytic domain
additional information
-
the enzyme contains a dsRNA binding and a catalytic subdomain
additional information
-
composed of an endonuclease domain (endoND) followed by a dsRNA-binding domain (dsRBD)
additional information
-
consisting only of the RNase III catalytic domain
additional information
-
Dicer-2 contains C-terminal RNase III domains, that mediate RNA cleavage, and an N-terminal helicase motif
additional information
-
the RNA binding and enzymatic domains of Drosha are located on its C-terminus, the N-terminus harbors a nuclear localization signal
additional information
-
domain structure: the enzyme Dicer is composed of helicase domain, N-terminal domain, PAZ domain, two RNase III domains, and dsRNA binding domain, comparison of class I-III enzymes, overview
additional information
-
domain structure: the enzyme Dicer is composed of helicase domain, N-terminal domain, PAZ domain, two RNase III domains, and dsRNA binding domain, while enzyme Drosha is composed of P-rich domain, RS-rich domain, two RNase III domains, and dsRNA binding domain, comparison of class I-III enzymes, overview
additional information
-
domain structure: the enzyme is composed of helicase domain, N-terminal domain, PAZ domain, two RNase III domains, and dsRNA binding domain, comparison of class I-III enzymes, overview
additional information
-
domain structure: the enzyme is composed of N-terminal domain, RNase III domain and dsRNA binding domain, comparison of class I-III enzymes, overview
additional information
-
domain structure: the enzyme is composed of RNase III domain and dsRNA binding domain, comparison of class I-III enzymes, overview
additional information
-
domain structures of isozymes DCL1-4 are all composed of helicase domain, N-terminal domain, PAZ domain, two RNase III domains, and dsRNA binding domain, only CL-1 shows a double dsRNA binding domain and DCL3 lacks the N-terminal domain. Comparison of class I-III enzymes, overview
additional information
-
domain structures: the enzyme Drosha is composed of P-rich domain, two RNase III domains, and dsRNA binding domain. The enzyme Dicer-1 is composed of truncated helicase domain, N-terminal domain, PAZ domain, two RNase III domains, and dsRNA binding domain, and enzyme Dicer-2 is composed of helicase domain, N-terminal domain, PAZ domain, two RNase III domains, and dsRNA binding domain. Comparison of class I-III enzymes, overview
additional information
-
inability of the Drosha dsRBD to form a stable complex on its own with dsRNA. Dicer structure analysis, overview
additional information
-
the enzyme binds siRNA as a dimer
POSTTRANSLATIONAL MODIFICATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
phosphoprotein
-
two phosphorylation sites at Ser300 and Ser302, which locates Drosha to the nucleus
phosphoprotein
-
phosphorylation on a serine in the RNase III domain activates the enzyme, the covalent modification facilitates product release, which is the rate-limiting step in the catalytic pathway
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
12 three-dimensional structures of bacterial RNase III in various forms have been reported; in complex with dsRNA, in the presence of Mg2+ or Mn2+ one metal ion bound per polypeptide chain
-
Aquifex aeolicus RNase III also has been cocrystallized with dsRNA or specific hairpin substrates
-
crystal structure analysis of wild-type enzyme and D44N mutant enzyme
-
crystal structure of Aquifex aeolicus mutant enzyme D44N with double-stranded RNA bound in its catalytic valley; the structure of Aa-D44N RNase III in complex with a RNA product is determined at a resolution of 2.05 A
-
hanging-drop vapour-diffusion method at 19C. Crystallisation of the mutant enzyme E110Q in complex with dsRNA 2-2 formed by self-complementary sequence 5'-CGAACUUCGCG-3', complex of wild-type enzyme with dsRNA 3-3 formed by self-complementary sequence 5'-AAAUAUAUAUUU-3', complex of wild-type enzyme with dsRNA 4-4 formed by self-complementary sequence 5'-CGCGAAUUCGCG-3' and complex of mutant enzyme E110Q with dsRNA 4-4 formed by self-complementary sequence 5'-CGCGAAUUCGCG-3'
-
three crystal structures of RNase III in complex with double-stranded RNA are solved at resolutions ranging from 1.7 to 2.9 A
-
12 three-dimensional structures of bacterial RNase III in various forms have been reported
P0A7Y0
hanging-drop vapour-diffusion method, 1.2 M magnesium sulfate and 0.1 M MES pH 6.5, purified recombinant Escherichia coli RNase G is crystallized in the cubic space group F432, with unit-cell parameters a = b = c = 219.84 A, resolution 3.4 A
P0A9J0
crystal structure analysis, PDB ID 2ffl, crystallographic analysis of the minimal Dicer of Giardia intestinalis, containing the PAZ and tandem RNase III domainsl
A8BQJ3
recombinant protein including His-tag by sitting drop vapor diffusion method
-
recombinant RNase IIIb-dsRBD fragment by sitting drop vapor diffusion method
-
handing drop vapor diffusion method, crystallization of a catalytically active fragment of mouse Dicer, containing the RNase IIIb and dsRNA binding domains, in its apo and Cd2+-bound forms
Q8R418
crystal structure analysis, PDB ID 2A11
P9WH03
crystal structure of enzyme Rnt1p in complex with a G2 loop
-
crystal structure analysis, PDB ID 1O0W
-
RNA-free structure of full length RNase III, comparison with crystal structures of Aquifex aeolicus RNase-dsRNA complex indicates dramatic conformational changes upon dsRNA binding
-
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
30 - 85
-
Aa-RNase III activity increases from 35C, reaching a maximum at 70C, and shows significant activity up to 85C
716385
37
-
30 min, no loss af activity
134361
50
-
30 min, 50% loss af activity
134361
100
-
nonspecific cleavage of RNA after heating for 1 min
134349
additional information
-
hyperthermophilic bacterium
694007
STORAGE STABILITY
ORGANISM
UNIPROT
LITERATURE
-20C, 25 mM Tris, pH 8, 8% (NH4)2SO4, 50% glycerol, several months, no loss of activity
-
-70C, 1.3 M NH4Cl, 2 years, 40-50% loss of activity
-
-20C, purified recombinant non-tagged enzyme, over one year without loss of activity
Paramecium bursaria Chlorella virus-1
-
-20C, 40 mM Tris-HCl, pH 7.5, 300 mM NaCl, 1 mM EDTA, 5 mM 2-mercaptoethanol, 50% glycerol
A6YSL1
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
; mutant enzyme D44N
-
Ni2+ affinity column
-
recombinant protein using His-tag
-
gel filtration analysis on a Superdex 75 10/30 column
O31418
of the native and recombinant protein
-
recombinant His6-tagged wild-type and mutant Dicer-2 from Sf21 insect cells by nickel affinity and heparin affinity chromatography, followed by gel filtration
-
affinity chromatography. RNase III heterodimers also can be purified from the inclusion body
-
of the overexpressed protein
-
of the overexpressed protein in yeast
-
partially RNase O
-
recombinant His-tagged enzyme to over 90% purity
-
recombinant His-tagged RNase III from Escherichia coli by nickel affinity chromatography
-
recombinant HIs-tagged wild-type and mutant enzymes
-
recombinant hybrid proteins to homogeneity
-
recombinant mutant enzymes
-
recombinant tagged heterodimer and homodimers from strain BL21 to homogeneity
-
Ni sepharose high performance chromatography, Q high performance chromatography
P0A9J0
of the human immunodeficiency virus type 1 reverse transcriptase
-
purified on a Ni2+-NTA superflow column
-
recombinant C-terminally His6-tagged enzyme from Escherichia coli BL21(DE3) Codon Plus by metal affinity chromatography
-
recombinant protein
-
recombinant protein using His-tag
-
partially
-
recombinant enzyme using His-tag
Q8R418
recombinant intein-tagged enzyme from Escherichia coli, to homogeneity, intein-tag is cleaved off
Paramecium bursaria Chlorella virus-1
-
of the native and recombinant protein
-
recombinant hybrid proteins to homogeneity
-
six-His fusion protein is purified from the soluble fraction using Ni-nitrilotriacetic resin
Q5YF04
recombinant His-tagged wild-type and mutant enzymes from Escherichia coli
-
recombinant His-tagged wild-type and mutant enzymes from Escherichia coli, expression of the mutant enzymes in a two-hybrid system in Saccharomyces strains
-
Ni2+ affinity column
-
purified by affinity chromatography on amylose-coupled agarose resin, recombinant RNC1 binds RNA but lacks endonuclease activity
A6YSL1
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
expression in Escherichia coli BL21(DE3)rnc105,recA
-
expression of mutant enzyme D44N in Escherichia coli; the full-length Aa-D44N is cloned for overproduction of the enzyme in Escherichia coli BL21DE3 CodonPlus-RIL cells
-
cDNA fragment encoding amino acids 1-391, expression as His-tag fusion protein
-
overexpression of the rncS gene in Escherichia coli
-
construction of transgenic lines by microinjection of a DNA vector encoding the enzyme and the green fluorescent protein
-
expression of GFP-tagged wild-type and mutant enzymes in nuclei of HeLa, HEK293T, and Huh-7 cells
-
expression of His6-tagged wild-type and mutant Dicer-2 in Spodoptera frugiperda Sf21 cells
-
analysis of the rnd gene in Escherichia coli
-
expressed in Escherichia coli BLR(DE3) cells
-
expression of a His-tagged E117Q mutant homodimer, a GST-tagged wild-type homodimer, and a His-tagged and GST-tagged wild-type/mutant heterodimer in strain BL21
-
gene rnc, expression of wild-type and mutant enzymes in strain BL21(DE3) as His-tagged enzymes
-
gene rnc, mapping at 55 min on the bacterial chromosome, overexpression of His-tagged enzyme in Escherichia coli strain BL21(DE3)
-
gene rnc, overexpression of wild-type and mutants in strain BL21(DE3) as His-tagged proteins
-
mutant proteins expressed in Escherichia coli
-
overexpression in Saccharomyces cerevisiae
-
overexpression of mutant hybrid proteins in Escherichia coli strain HMS174
-
overexpression of the rnc gene in Escherichia coli
-
recombinant expression of His-tagged RNase III in Escherichia coli
-
expression in Escherichia coli BL21 (DE3)
P0A9J0
orf27, virus RNase III phylogenetic analysis
-
cloning of full-length cDNA of DICER1 protein from HeLa cell total RNA, and expression of N-terminally FLAG-tagged DICER1 protein in 293T cells
-
expressed as a 6His-tagged fragment in Escherichia coli BL21 strain
-
expression of His-tag fused RNase IIIb-dsRBD fragment of human Dicer (residues 1649-1922) in Escherichia coli HT115
-
recombinant expression of C-terminally His6-tagged enzyme in Escherichia coli BL21(DE3) Codon Plus
-
region encoding the RNase IIIb domain (residues 1660-1852) expressed as His-tag fusion protein in Escherichia coli BL21 star (DE3)
-
expression in Escherichia coli. The lactococcal enzyme is able to substitute for Escherichia coli RNase III not only in the rRNA processing, but also in the processing of mRNAs. The amount of lactococcal rnc transcript in an Escherichia coli D strain is 3.3fold higher than in the wild type strain, suggesting that the Escherichia coli RNase III triggers the degradation of the heterologous rnc mRNA
-
Dicer fragment RNase IIIb + dsRBD expressed as His-tag fusion protein in Escherichia coli BL21(DE3)
Q8R418
orf A464R, expression in Escherichia coli ER2566 using the chitin-binding intein system
Paramecium bursaria Chlorella virus-1
-
overexpression of mutant hybrid proteins in Escherichia coli strain HMS174
-
overexpression of the rnc gene in Escherichia coli
-
expressed in Escherichia coli BL21(DE3)
Q5YF04
expression of GFP-tagged Rnt1p in Saccharomyces cerevisiae strain W303 from plasmid pCS321
-
expression of N-terminal and dsRNA binding domain in a two-hybrid system, expression of His-tagged wild-type enzyme and deletion mutants in Escherichia coli BL21(DE3)
-
expression of wild-type and mutant enzymes in Escherichia coli BL21(DE3) as C-terminally His-tagged proteins
-
gene mc, DNA and amino acid sequence determination and analysis
-
overexpressed in Escherichia coli
-
gene rnc, DNA and amino acid sequence determination and analysis, cloning in the overexpression vector pIJ8600
U3GP13
expressed in Escherichia coli
Q9ZBQ7
expressed in Escherichia coli strain BL21
Q9ZBQ7
expression in Escherichia coli BL21(DE3)rnc105,recA
-
into the pMAL-c2X vector, containing a TEV protease cleavage site at the EcoRI site, for expression in Escherichia coli Rosetta 2 cells
A6YSL1
EXPRESSION
ORGANISM
UNIPROT
LITERATURE
the Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing
-
Micro-drosha siRNAs-1 to -3 yield a very highly significant level of target transcript knockdown compared with the control siRNA following egg-stage soaks, with a mean 88.1%, 98.6%, and 99.89% decrease, respectively. Soaking the J2s in dicer siRNA results in a modest decrease in dicer transcript abundance
-
Micro-dicer siRNAs-1 to -3 elicit percentage transcript increases of 775, 1832 and 645, respectively
-
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
D44N
-
mutant enzyme with greatly reduced activity, mutant with greatly reduced activity
D44N
-
mutation of the cleavage site
D44N
-
site-directed mutagenesis, the mutation does not fully inactivate the enzyme, and dsRNA cleavage occurs during crystallization of the mutant enzyme
E110A
-
uncoupling of the dsRNA-binding and processing abilities of the enzyme
E110K
-
loss of Mg2+ binding capacity, non-functional, uncoupling of the dsRNA-binding and processing abilities of the enzyme, mutation of the cleavage site
E110Q
-
mutant enzyme has negligible RNA cleavage activity but retains its RNA binding affinity
E110Q
-
uncoupling of the dsRNA-binding and processing abilities of the enzyme
D1217N/D1614N
-
site-directed mutagenesis of Dicer-2
G31R
-
site-directed mutagenesis of Dicer-2
S300A
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S300A/S302A
-
site-directed mutagenesis, the double mutation completely disrupts nuclear localization
S300E
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S300E/S302D
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S302A
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
S302D
-
site-directed mutagenesis, the mutant localizes to the nucleus like the wild-type enzyme
D114A
-
mutant exhibits catalytic activity in vitro in 10 mM Mg2+ buffer that is comparable to that of the wild-type enzyme. At 1 mM Mg2+, the activity is significantly lower, KM-value for Mg2+ is about 2.8fold larger than the wild-type value
D45A
-
mutant enzyme exhibits negligible activity, regardless of the Mg2+ concentration
D45E
-
activity is partially rescued by Mn2+, mutant enzyme exhibits negligible activity, regardless of the Mg2+ concentration
D45N
-
mutant enzyme exhibits negligible activity, regardless of the Mg2+ concentration
E100A
-
mutant enzyme requires higher Mg2+ concentrations for optimal activity than the wild-type enzyme
E117D
-
site-directed mutagenesis, mutant exhibits normal homodimeric behaviour, can bind substrates but shows highly reduced hydrolysis activity compared to the wild-type enzyme
E117Q
-
mutant enzyme can still bind to the substrate RNA in presence of Mg2+ but cannot cleave it
E117Q
-
site-directed mutagenesis, mutant exhibits normal homodimeric behaviour, can bind substrates but is unable to cleave the substrates
E38A
-
mutant enzyme requires higher Mg2+ concentrations for optimal activity than the wild-type enzyme
E38A
-
single amino acid substitution, preventing cleavage at the secondary site. RNase III(E38A) generates discrete-sized products
E41A
-
mutant exhibits catalytic activity in vitro in 10 mM Mg2+ buffer that is comparable to that of the wild-type enzyme. At 1 mM Mg2+, the activity is significantly lower, KM-value for Mg2+ is about 2.8fold larger than the wild-type value
E41A/D114A
-
KM-value for Mg2+ is about 85fold larger than the wild-type value
E65A
-
mutant enzyme requires higher Mg2+ concentrations for optimal activity than the wild-type enzyme
R206H
P0A9J0
manipulations during cloning
D1709A
-
strongly reduced dsRNA cleavage activity
D1713A
-
no significant effect on the cleavage activity
D1713K
-
no significant effect on the cleavage activity
D1810A
-
reduced dsRNA cleavage activity
DELTA1787-1799
-
no significant effect on the cleavage activity
E1705A
-
reduced dsRNA cleavage activity
K1790A
Q8R418
significantly reduced activity
K1790R
Q8R418
significantly reduced activity
K1790S
Q8R418
significantly reduced activity
K371A
-
dissociation constant for RNA is 2.1fold higher than the wild-type value
M368A
-
dissociation constant for RNA is 1.4fold higher than the wild-type value
R372A
-
dissociation constant for RNA is nearly identical to wild-type value
D63A
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
D63A
Staphylococcus aureus RN6390
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
-
Q157A
-
is a conserved glutamine in the Aa-RNase III dsRNA-binding domain. Aa-RNase III cleavage of the pre-16S substrate is blocked by the Q157A mutation, which reflects a loss of substrate binding affinity. But the Q157A mutation does not affect folding or structure in a significant manner
additional information
O31418
DELTAmrnC strain has no major difference in growth rate compared with wild-type, but reaches a slightly lower saturation density
additional information
-
several pnp alleles constructed. Deletion DELTApnpL1001, which removes the upper (central) part of the large stem-loop (SL1) that serves as a substrate for RNase III
additional information
-
dcr-1 gene N-terminal deletion and null mutants show defective RNAi and are steril, overview
G97E
-
increases requirement for Mg2+
additional information
-
construction of a heterodimer comprising one functional wild-type subunit and one inactive E117Q mutant subunit, which carries the E117Q mutation allowing the mutant subunit to bind but not cleave the substrate, the functional subunit is sufficient for catalytic activity of the heterodimer
additional information
-
construction of a mutant enzyme RNase III[DELTAdsRBD] lacking the dsRNA binding domain, the mutant is still catalytically active at low salt concentrations in presence of either 25 mM Mg2+ or 5 mM Mn2+ with slightly reduced catalytic efficiency, but unaltered substrate specificity
additional information
-
construction of hybrid proteins consisiting of the N-terminal nuclease domain of Rhodobacter capsulatus and the C-terminal dsRNA-binding domain of Escherichia coli and vice versa, extension of the spacer region between the N-terminal and C-terminal domains does not alter the cleavage specificity
additional information
-
the stability of rpoS mRNA, and concomitantly the concentration of deltaS, are significantly higher in an RNase III-deficient mutant. Investigation of the dsrA mutant (rnc+dsrA-) and its isogenic variant lacking functional RNase III (rnc-dsrA-)
additional information
-
construction of mutant strain MG1655rnc-14::DELTATn10
additional information
-
construction of strain MG1655 rnc-14::DELTATn10 from wild-type straiin HT115
Q153P
P0A7Y0
the Q153P substitution in the middle of the flexible linker between the endoND and the dsRBD abolish RNA-cleavage activity
additional information
-
construction of strain MG1655 rnc-14::DELTATn10 from wild-type straiin HT115
-
Q153P
Escherichia coli K12
-
the Q153P substitution in the middle of the flexible linker between the endoND and the dsRBD abolish RNA-cleavage activity
-
additional information
Escherichia coli MG1655
-
construction of mutant strain MG1655rnc-14::DELTATn10
-
E1813A
-
strongly reduced dsRNA cleavage activity
additional information
-
various deletion mutants of human Dicer
additional information
-
construction of mutant enzymes containing inserts encoding the enzyme's heparin binding region HBR1, HBR2, or HBR3 by site-directed mutagenesis, cytotoxicity of wild-type and mutant enzymes to Beas-2B cells, overview
K1790T
Q8R418
significantly reduced activity
additional information
-
construction of hybrid proteins consisting of the N-terminal nuclease domain of Rhodobacter capsulatus and the C-terminal dsRNA-binding domain of Escherichia coli and vice versa
M368E
-
dissociation constant for RNA is nearly identical to wild-type value
additional information
-
construction of deletion mutants RNT1DELTA2-329 and RNT1DELTA2-198, which are both catalytically active in vitro but do not rescue a growth defective mutant and are not able to retain activity and viability in vivo, construction of a AGNN-loop exchange mutant GNRA-loop shows reduced activity and substrate selectivity
additional information
-
construction of several deletion mutants, lacking parts or total of the C-terminus or N-terminus, deletion of the N-terminal domain leads to slight accumulation of unprocessed 25S pre-rRNA in vivo and reduced enzyme activity in vitro
additional information
-
building a class of RNA sensing actuation devices based on direct integration of RNA aptamers into a region of the RNase III Rnt1p hairpin that modulates Rnt1p cleavage rates, design of an Rnt1p switch platform based on direct replacement of the CEB with an aptamer sequence. Integration of a sensor component, DELTATCT-4 aptamer, into the actuator component, R31L-3B4Inv Rnt1p hairpin. Ligand binding to the integrated aptamer domain is associated with a structural change sufficient to inhibit Rnt1p processing, overview. Three tuning strategies based on the incorporation of different functional modules into the Rnt1p switch platform optimize switch dynamics and ligand responsiveness. Application of multiple switch modules decreases theophylline responsiveness and increases fold-change. The tuning modules can be implemented combinatorially in a predictable manner to further improve the regulatory response properties of the switch. The modularity and tunability of the Rnt1p switch platform will allow for rapid optimization and tailoring of this gene control device. Method evaluation and system stabililty, overview
S376E
-
dissociation constant for RNA is 1.3fold higher than the wild-type value
additional information
-
construction of an enzyme deficient mutant which has a strongly reduced growth rate compared with the wild type, the sRNA MicA is found to be extremely stable in the deficiency mutant
E135A
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
additional information
-
rnc mutant (obtained by homologous recombination) is viable. Deletion of the rnc gene in Staphylococcus aureus does not affect cell growth in rich medium
additional information
-
construction of an RNase III inactivation mutant DELTArnc from Staphylococcus aureus strain 8325-4. The DELTArnc strain shows reduced extracellular protein levels and is less pathogenic compared with its parent strain
additional information
-
effect of mutations in the catalytic site of Staphylococcus aureus RNase III, overview
additional information
Staphylococcus aureus 8325-4
-
construction of an RNase III inactivation mutant DELTArnc from Staphylococcus aureus strain 8325-4. The DELTArnc strain shows reduced extracellular protein levels and is less pathogenic compared with its parent strain
-
E135A
Staphylococcus aureus RN6390
-
site-directed mutagenesis, analysis of binding specificity and target sites compared to the wild-type enzyme
-
additional information
Staphylococcus aureus RN6390
-
effect of mutations in the catalytic site of Staphylococcus aureus RNase III, overview
-
additional information
U3GP13
generation of a disruption mutant of the chromosomal RNase III gene rnc by insertional mutagenesis, the mutant strain shows reduced actinomycin production. Complementation of mutant strain JSE1980 with pJSE1995 encoding the wild-type rnc gene restores actinomycin production to nearly wild-type levels
additional information
Streptomyces antibioticus IMRU 3720
-
generation of a disruption mutant of the chromosomal RNase III gene rnc by insertional mutagenesis, the mutant strain shows reduced actinomycin production. Complementation of mutant strain JSE1980 with pJSE1995 encoding the wild-type rnc gene restores actinomycin production to nearly wild-type levels
-
D70A
Q9ZBQ7
constructed point mutation, abolishes the catalytic activity of the protein but not its ability to bind to RNA substrates
additional information
-
constructed RNase III null mutant, phenotypic analysis
additional information
Q9ZBQ7
rnc null mutant of Streptomyces coelicolor M145 does not produce actinorhodin or undecylprodigiosin. The strain bearing the disrupted rnc gene was designated JSE1880
D70A
Streptomyces coelicolor M145
-
constructed point mutation, abolishes the catalytic activity of the protein but not its ability to bind to RNA substrates
-
additional information
Streptomyces coelicolor M145
-
rnc null mutant of Streptomyces coelicolor M145 does not produce actinorhodin or undecylprodigiosin. The strain bearing the disrupted rnc gene was designated JSE1880
-
additional information
-
the catalytically inactive mutant RNase3-Ala can bind the substrates like 22 nt ds-siRNA or 60 bp dsRNA, formation of high-molecular-mass RNA-protein complexes
D218A
-
site-directed mutagenesis, inactive mutant
additional information
-
inducible knockdown of mRPN1 in Trypanosoma brucei results in loss of gRNA and accumulation of precursor transcripts, consistent with a role of mRPN1 in processing
Renatured/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
renaturation by stepwise removal of urea by dialysis
-
APPLICATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
additional information
-
drosha, pasha and their ancillary factors may represent excellent targets for novel nematicides and/or in planta controls, and potentially other parasitic nematodes, through disruption of micro-RNA-directed developmental pathways