Information on EC 3.1.11.5 - exodeoxyribonuclease V

Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Mark a special word or phrase in this record:
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)


The expected taxonomic range for this enzyme is: Bacteria, Archaea, Eukaryota

EC NUMBER
COMMENTARY
3.1.11.5
-
RECOMMENDED NAME
GeneOntology No.
exodeoxyribonuclease V
REACTION
REACTION DIAGRAM
COMMENTARY
ORGANISM
UNIPROT ACCESSION NO.
LITERATURE
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides
show the reaction diagram
preference for double-stranded DNA, possesses DNA-dependent ATPase activity, acts endonucleolytically on single-stranded circular DNA
-
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides
show the reaction diagram
mechanism, The enzyme is an ATP-dependent DNA exonuclease and a helicase, its exonuclease activity is subject to regulation by an octameric nucleotide sequence called chi.
-
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides
show the reaction diagram
The enzyme is involved initiating DNA recombination. The nuclease properties of the enzyme are regulated upon recognition of a specific DNA sequence by the translocating enzyme. This sequence, called chi, corresponds to the octamer 5-GCTGGTGG-3.
-
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides
show the reaction diagram
The enzyme generates 3 single-stranded DNA ends used by RecA for homologous recombination. The exonuclease activity is altered when the enzyme encounters a Chi sequence, 5-GCTGGTGG-3, in double-stranded DNA, an event critical to generation of 3 single-stranded DNA. Chi recognition requires that Chi be flanked by DNA at either end. A specific site for Chi recognition exists on enzyme, which binds Chi with greater affinity than a non-Chi sequence and is probably adjacent to non-specific DNA binding sites.
-
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides
show the reaction diagram
The enzyme is required for homologous recombination and DNA repair, the degradative and recombinational activities of enzyme, as well as its structure, are regulated by a specific DNA sequence called Chi. The recombination requires loading of RecA by RecBCD enzyme and that the RecD subunit inhibits this reaction.
-
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides
show the reaction diagram
-
-
-
-
REACTION TYPE
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
DNA-dependent ATPase activity
-
-
-
-
hydrolysis of phosphoric ester
-
-
-
-
SYNONYMS
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
AddAB enzyme
-
-
E. coli ATP-dependent DNase
-
-
-
-
E. coli exonuclease V
-
-
-
-
Escherichia coli exonuclease V
-
-
-
-
Escherichia coli RecBCD
-
-
-
-
Exodeoxyribonuclease V 125 kDa polypeptide
-
-
-
-
Exodeoxyribonuclease V 135 KDA polypeptide
-
-
-
-
Exodeoxyribonuclease V 67 kDa polypeptide
-
-
-
-
exonuclease V
-
-
-
-
exonuclease V
-
-
ExoV
Escherichia coli K12
-
-
-
gene recBC DNase
-
-
-
-
gene RecBC endoenzyme
-
-
-
-
nuclease, exodeoxyribo V
-
-
-
-
PAB2263
Q9V2E8
-
REcB30 protein
-
universal nuclease domain of REcBCD
recBC deoxyribonuclease
-
-
-
-
recBC DNase
-
-
-
-
recBC nuclease
-
-
-
-
RecBCD
P08394 and P04993 and P07648
-
RecBCD DNase
-
-
recBCD enzyme
-
-
-
-
recBCD enzyme
-
-
recBCD enzyme
-
-
recBCD enzyme
-
-
-
RecBCD exonuclease
-
-
RecBCD exonuclease
Escherichia coli JM109
-
-
-
UPF0286 protein PYRAB01260
Q9V2E8
-
CAS REGISTRY NUMBER
COMMENTARY
37350-26-8
-
ORGANISM
COMMENTARY
LITERATURE
SEQUENCE CODE
SEQUENCE DB
SOURCE
strains JV28, KOM18, KOM45 and EK6
-
-
Manually annotated by BRENDA team
BL21 strain and BL21-RecD-SBP strain
-
-
Manually annotated by BRENDA team
mutants lacking the recB or recC or recD gene
-
-
Manually annotated by BRENDA team
RecB beta chain and REcD alpha chain and Rec C gamma chain
P08394 and P04993 and P07648
UniProt
Manually annotated by BRENDA team
RecB2109 gene
UniProt
Manually annotated by BRENDA team
recB2109CD mutant
-
-
Manually annotated by BRENDA team
rorA mutant
-
-
Manually annotated by BRENDA team
thermosensitive mutants with thermolabile adenosine 5'-triphosphate-dependent exonucleolytic hydrolysis of duplex DNA
-
-
Manually annotated by BRENDA team
Escherichia coli JM109
-
-
-
Manually annotated by BRENDA team
Escherichia coli K12
K12
-
-
Manually annotated by BRENDA team
Micrococcus luteus
-
-
Manually annotated by BRENDA team
three genes, recC, recB, and recD, in the recCBD operon
-
-
Manually annotated by BRENDA team
three genes, recC, recB, and recD, in the recCBD operon
-
-
Manually annotated by BRENDA team
GENERAL INFORMATION
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
malfunction
-
individual null-mutations of all three genes, recC, recB, and recD, or the deletion of whole recCBD operon of Pseudomonas syringae, lead to growth inhibition at low temperature, and sensitivity to UV and mitomycin C. Viability of the mutant cells drops drastically at 4C, and the mutants accumulate linear chromosomal DNA and shorter DNA fragments in higher amounts compared to 22C
malfunction
-
individual null-mutations of all three genes, recC, recB, and recD, or the deletion of whole recCBD operon of Pseudomonas syringae, lead to growth inhibition at low temperature, and sensitivity to UV and mitomycin C. Viability of the mutant cells drops drastically at 4C, and the mutants accumulate linear chromosomal DNA and shorter DNA fragments in higher amounts compared to 22C
-
physiological function
-
type I DNA restriction/modification systems are oligomeric enzymes capable of switching between a methyltransferase function on hemimethylated host DNA and an endonuclease function on unmethylated foreign DNA. Reuse of the methyltransferase subunits is possible so that restriction proceeds until the restriction subunits are depleted. RecBCD exonuclease halts restriction and does not assist recycling, influence of RecBCD on the EcoKI type I restriction enzyme, overview
physiological function
-
RecD associates with two other proteins RecB and RecC to produce RecBCD enzyme, which is involved in homologous recombination and DNA repair in many bacteria, including Escherichia coli. All three subunits of the RecBCDPs enzyme are essential for DNA repair and growth of Pseudomonas syringae at low temperatures of 4C. The RecD requirement is only a function of the RecBCD complex in the bacterium. The RecBCD pathway protects the Antarctic bacterium from cold-induced DNA damages, and is critically dependent on the helicase activities of both RecB and RecD subunits, but not on the nuclease of RecBCDPs enzyme
physiological function
Escherichia coli JM109
-
type I DNA restriction/modification systems are oligomeric enzymes capable of switching between a methyltransferase function on hemimethylated host DNA and an endonuclease function on unmethylated foreign DNA. Reuse of the methyltransferase subunits is possible so that restriction proceeds until the restriction subunits are depleted. RecBCD exonuclease halts restriction and does not assist recycling, influence of RecBCD on the EcoKI type I restriction enzyme, overview
-
physiological function
-
RecD associates with two other proteins RecB and RecC to produce RecBCD enzyme, which is involved in homologous recombination and DNA repair in many bacteria, including Escherichia coli. All three subunits of the RecBCDPs enzyme are essential for DNA repair and growth of Pseudomonas syringae at low temperatures of 4C. The RecD requirement is only a function of the RecBCD complex in the bacterium. The RecBCD pathway protects the Antarctic bacterium from cold-induced DNA damages, and is critically dependent on the helicase activities of both RecB and RecD subunits, but not on the nuclease of RecBCDPs enzyme
-
SUBSTRATE
PRODUCT                      
REACTION DIAGRAM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
34-mer ssDNA + H2O
?
show the reaction diagram
-
REcB30 binds more tightly on ssDNA than on dsDNA but is more active on dsDNA than on ssDNA
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
-
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
r
ATP + H2O
ADP + phosphate
show the reaction diagram
-
reduced activity in recB2109CD mutant
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
ATPase activity in recBC enzyme
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
linear DNA dependent
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
linear DNA dependent
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
DNA binds more rapidly to enzyme-ATP komplex
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
DNA binds more rapidly to enzyme-ATP komplex
-
-
r
ATP + H2O
ADP + phosphate
show the reaction diagram
-
individual RecB protein has ATPase activity
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
RNA-DNA hybrids or cross-linked DNA can serve as cofactors
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
complete inhibition of DNAse activity has no effect on ATPase activity
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
biphasic activity represents DNA unwinding and ATPase activity
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
activity on T7DNA
-
-
?, r
ATP + H2O
ADP + phosphate
show the reaction diagram
-
DNA dependent
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
-
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
mechanism
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
at presence of low Mg2+
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
unwinding in the presence of E. coli binding protein SSB or high levels of ATP
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
no recombination in recB2109CD mutants and abc-modified recBCD mutants
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
reduced unwinding activity in abc-modified recBCD protein
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
loop is formed on the same strand that is cut by the enzyme near chi
-
-
-
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
loop is formed on the same strand that is cut by the enzyme near chi
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
unwinding activity in the recBC enzyme
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
no unwinding on replicative form DNA
-
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
-
recB2109CD mutant has no chi nicking activity
-
-
?
double-stranded DNA
single stranged DNA
show the reaction diagram
-
unwinding of double-stranded DNA
substrate for the DNA strand-exchange protein, RecA, model for chi-induced RecA protein loading by RecBCD enzyme, substrate for the DNA strand-exchange protein, RecA
?
double-stranded DNA
single-stranded DNA fragments
show the reaction diagram
-
ATP dependent double-stranded DNA exonuclease and processive DNA helicase
-
?
double-stranded DNA
single-stranded DNA fragments
show the reaction diagram
-
the enzyme is a powerful and processive DNA helicase, a potent double-stranded DNA exonuclease and an ATPase, the enzyme is regulated by a Chi cognate sequence, the degradation of DNA by enzyme is nearly symmetrical on the both strands, the enzyme plays a an important role in the initiation of DNA recombination and recombinant-dependent DNA replication
-
?
double-stranded DNA
single-stranded DNA fragments
show the reaction diagram
-
the enzyme plays a an important role in the initiation of DNA recombination and recombinant-dependent DNA replication
-
?
double-stranded DNA
3'-ended stretch of single-stranded DNA
show the reaction diagram
-
the enzyme is a ATP dependent helicase and exonuclease
-
?
double-stranded DNA
single-stranded DNA
show the reaction diagram
-
ATP-dependent, unwinding of DNA molecule
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
mechanism
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
no exonuclease activity in recD null mutants
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
slower degradation of UV-irradiated DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
reduced activity in abc-modified recBCD protein
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
supplies nucleotides for break repair of DNA
-
-
-
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
active on vaccina virus DNA containing terminal crosslinks
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
binds specifically to linear DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
processive activity on T7DNA
-
-
-
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
processive activity on T7DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
acts on native, heat-denatured and glucosylated DNA
-
-
-
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
acts on native, heat-denatured and glucosylated DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
reduced activity in recB2109CD mutant
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
a gap of 5 nucleotides in circular DNA needed for activity
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
no activity on circular DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
no activity on circular DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
no activity on circular DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
can release pyrimidine primer from UV-irradiated DNA
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
only ATP-dependent exonuclease activity is altered in thermolabile recB and recC mutants
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP dependent double-stranded DNA exonuclease
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP dependent double-stranded DNA exonuclease
-
-
-
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP dependent double-stranded DNA exonuclease
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
responsible for several steps in genetic recombination process
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP-dependent exonuclease
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP-dependent helicase
-
-
-
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP-dependent helicase
-
-
?
double-stranded DNA + H2O
?
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
?
show the reaction diagram
-
BL21 and BL21-RecD-SBP strains share similar linear DNA degradation activities
-
-
?
douple-stranded DNA
?
show the reaction diagram
-
the enzyme has potent nuclease and helicase activity, the enzyme is required for the major pathway of double-strand DNA break repair and genetic exchange, the enzyme has potent nuclease and helicase activity
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
no exonuclease activity in recD null mutants
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
active on vaccina virus DNA containing terminal crosslinks
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
reduced activity in recB2109CD mutant
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
endonuclease activity is ATP dependent in recBC enzyme
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
no endonuclease activity, degrades only single stranded DNA from 5'-end, not ATP dependent
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
also endonuclease activity on circular DNA
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
also endonuclease activity on circular DNA
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP dependence varies
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP dependence varies
-
-
-
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP dependence varies
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP dependence varies
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
rate of degradation is less than double-stranded DNA
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
rate of degradation is less than double-stranded DNA
-
-
-
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
rate of degradation is less than double-stranded DNA
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
no stimulation with ATP
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP-dependent exonuclease
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP-dependent endonuclease
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP-stimulated endonuclease
-
-
?
dsDNA + H2O
?
show the reaction diagram
-
REcB30 binds more tightly on ssDNA than on dsDNA but is more active on dsDNA than on ssDNA
-
-
?
additional information
?
-
P08394
the RecA protein loading is an essential function of the enzyme
-
?
additional information
?
-
-
when expressed in Escherichia coli, the enzyme blocks the growth of phage gamma
-
?
additional information
?
-
-
first: The enzyme is a potent double-stranded DNA exonuclease that destroys linear DNA produced by restriction of foreign DNA. second: The enzyme promotes repair of double-stranded DNA breaks and genetic recombination in the vicinity of chi recombination hotspots.
-
?
additional information
?
-
-
the activities of enzyme responsible for the initiation of recombinantional and repair processes are required for UV-induced restriction alleviation
-
?
additional information
?
-
-
The enzyme is involved in the radiation-induced process know as prophage inactivation. The helicase activity of enzyme is responsible for the progressive loss of prophage recombinogenicity. This loss is most probably a consequence of the unsuccessful enzyme-dependent recombinational repair of double-stranded breaks in the cell chromosome, during which some structures unsuitable for further recombination reactions may be produced.
-
?
additional information
?
-
-
nucleolytic degradation of DNA by RecBCD is not necessary for intracellular Chi hotspot activity. Nicking of DNA by RecBCD enzyme at Chi is sufficient
-
-
-
additional information
?
-
-
RecBCD enzyme is a multifunctional heterotrimeric complex that possesses processive helicase and exonuclease activities. Upon encountering the DNA regulatory sequence, chi, the enzymatic properties of RecBCD enzyme are altered. Its helicase activity is reduced, the 3'-5' nuclease activity is attenuated, the 5'-3' nuclease activity is up-regulated, and it manifests an ability to load RecA protein onto single-stranded DNA. The net result of these changes is the production of a highly recombinogenic structure known as the presynaptic filament
-
-
-
additional information
?
-
-
RecD subunit signals the RecB subunit to cut DNA. the existence of a cascade of intersubunit signals from Chi-RecC to RecD to RecB is proposed
-
-
-
additional information
?
-
-
the nuclease reactions of the RecBCD-DNA complexes are initiated by mixing with ATP. The reaction is processive. The reaction begins near the 3'-end of the [5'-32P]DNA substrates and the major cleavage sites are two to four phosphodiester bonds apart. DNA cleavage is tightly coordinated with movement of the enzyme along the DNA. The reaction time-courses at low concentrations of ATP (0.1 mM and 0.025 mM) have a significant lag before cleavage products appear. We propose that the lag represents ATP-dependent movement of the DNA from an initial binding site in the helicase domain of the RecB subunit to the nuclease active site in a separate domain of RecB
-
-
-
additional information
?
-
P08394 and P04993 and P07648
the RecB nuclease domain affects the interaction of RecBC with the end of the 3'-ssDNA tail
-
-
-
additional information
?
-
-
RecD protein expression level is decreased at lower cultivation temperature, which greatly improves the productivity of cell-free protein synthesis from linear DNA templates
-
-
-
additional information
?
-
Escherichia coli K12
-
first: The enzyme is a potent double-stranded DNA exonuclease that destroys linear DNA produced by restriction of foreign DNA. second: The enzyme promotes repair of double-stranded DNA breaks and genetic recombination in the vicinity of chi recombination hotspots.
-
?
additional information
?
-
Escherichia coli K12
-
the activities of enzyme responsible for the initiation of recombinantional and repair processes are required for UV-induced restriction alleviation
-
?
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
-
-
-
-
r
ATP + H2O
ADP + phosphate
show the reaction diagram
-
DNA dependent
-
-
?
double-stranded DNA
single stranged DNA
show the reaction diagram
-
unwinding of double-stranded DNA
substrate for the DNA strand-exchange protein, RecA
?
double-stranded DNA
single-stranded DNA fragments
show the reaction diagram
-
the enzyme plays a an important role in the initiation of DNA recombination and recombinant-dependent DNA replication
-
?
double-stranded DNA
single-stranded DNA
show the reaction diagram
-
ATP-dependent, unwinding of DNA molecule
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
-
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
responsible for several steps in genetic recombination process
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP-dependent exonuclease
-
-
?
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP-dependent helicase
-
-
-
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
-
ATP-dependent helicase
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
-
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP-dependent exonuclease
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP-dependent endonuclease
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
-
ATP-stimulated endonuclease
-
-
?
douple-stranded DNA
?
show the reaction diagram
-
the enzyme is required for the major pathway of double-strand DNA break repair and genetic exchange, the enzyme has potent nuclease and helicase activity
-
?
additional information
?
-
P08394
the RecA protein loading is an essential function of the enzyme
-
?
additional information
?
-
-
first: The enzyme is a potent double-stranded DNA exonuclease that destroys linear DNA produced by restriction of foreign DNA. second: The enzyme promotes repair of double-stranded DNA breaks and genetic recombination in the vicinity of chi recombination hotspots.
-
?
additional information
?
-
-
the activities of enzyme responsible for the initiation of recombinantional and repair processes are required for UV-induced restriction alleviation
-
?
additional information
?
-
-
The enzyme is involved in the radiation-induced process know as prophage inactivation. The helicase activity of enzyme is responsible for the progressive loss of prophage recombinogenicity. This loss is most probably a consequence of the unsuccessful enzyme-dependent recombinational repair of double-stranded breaks in the cell chromosome, during which some structures unsuitable for further recombination reactions may be produced.
-
?
additional information
?
-
-
RecD protein expression level is decreased at lower cultivation temperature, which greatly improves the productivity of cell-free protein synthesis from linear DNA templates
-
-
-
additional information
?
-
Escherichia coli K12
-
first: The enzyme is a potent double-stranded DNA exonuclease that destroys linear DNA produced by restriction of foreign DNA. second: The enzyme promotes repair of double-stranded DNA breaks and genetic recombination in the vicinity of chi recombination hotspots.
-
?
additional information
?
-
Escherichia coli K12
-
the activities of enzyme responsible for the initiation of recombinantional and repair processes are required for UV-induced restriction alleviation
-
?
COFACTOR
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
IMAGE
ATP
-
the unwinding of
METALS and IONS
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
Ca2+
-
inhibitory in the presence of Mg2+
Ca2+
-
DNA-dependent ATPase unaffected; double-stranded DNA exonuclease and single-stranded DNA exonuclease and endonuclease activities completely inhibited
Ca2+
-
inhibitory on helicase activity in the presence of Mg2+
Ca2+
-
slight activation of ssDNA nuclease activity of RecB30
Cd2+
-
inhibitory in the presence of Mg2+
Co2+
-
stimulates at 1-2 mM
Co2+
-
activation of ssDNA nuclease activity of RecB30
Cu2+
-
slight activation of ssDNA nuclease activity of RecB30
Mg2+
-
required, optimal concentration around 3-12 mM
Mg2+
-
produces intermediates; required, optimal concentration around 3-12 mM
Mg2+
-
required, optimal concentration around 3-12 mM
Mg2+
P08394
the nuclease activities of wild-type enzyme is sensitive to the concentration of free magnesium ions in solution
Mg2+
-
required
Mg2+
-
activation of ssDNA nuclease activity of RecB30
Mg2+
-
activates
Mn2+
-
inhibitory in the presence of Mg2+
Mn2+
-
less effective than Mg2+
Mn2+
-
acts processively; more effective as Mg2+
Mn2+
-
activation of ssDNA nuclease activity of RecB30
Ni2+
-
slight activation of ssDNA nuclease activity of RecB30
Zn2+
-
slight activation of ssDNA nuclease activity of RecB30
INHIBITORS
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
IMAGE
abc protein
-
anti recBCD; binds the recBCD enzyme and inhibits recombination but not exonuclease activity; gamma-protein analog encoded by bacteriophage P22
-
ATP
-
0.2 mM and higher concentrations inhibits phosphodiester hydrolysis; neither the rate nor the extent of hydrolysis of single-stranded DNA nor ATP is affected
ATP
-
0.2 mM and higher concentrations inhibits phosphodiester hydrolysis; neither the rate nor the extent of hydrolysis of single-stranded DNA nor ATP is affected
ATP
-
0.2 mM and higher concentrations inhibits phosphodiester hydrolysis
bacteriophage Mu
-
induction of bacteriophage Mu causes inhibition of exonuclease V
-
d(GATCATTACTAGGCAGGTGG)
-
3'20-merChio
d(GATCATTACTAGGCTGGTGG)
-
3'20-merChi+
d(GATTAGGCaGGTGG)
-
3'14-merChio
d(GATTAGGCTGGTGG)
-
3'14-merChi+
d(GCAGGTGG)
-
8-merChio
d(GCAGGTGGGATCATTACTAG)
-
5'20-merChio
d(GCAGGTGGGATTAG)
-
5'14-merChio
d(GCTGGTGG)
-
8-merChi+
d(GCTGGTGGGATCATTACTAG)
-
5'20-merChi+
d(GCTGGTGGgattag)
-
5'14-merChi+
d(TACTAGGCaGGTGGGATCAT)
-
20-merChio
d(TACTAGGCTGGTGGGATCAT)
-
20-merChi+
d(TAGGCaGGTGGGAT)
-
14-merChio
d(TAGGCTGGTGGGAT)
-
14-merChi+
E. coli Bacteriophage proteins
-
-
-
E. coli single stranded DNA binding protein
-
SSB
-
E. coli single stranded DNA binding protein
-
ATPase activity complete inhibited by SSB
-
Gamma-protein
-
protein encoded by gam gene of bacteriophage lambda
-
NaCl
-
inhibitory at 40 mM and higher concentrations
NaCl
-
inhibitory to helicase activity
pyridoxal 5'-phosphate
-
-
small DNA fragments
-
-
thermostable protein
-
-
-
Gamma-protein
-
binds the recBCD enzyme and inhibits ATPase, exonuclease and endonuclease and helicase activity
-
additional information
-
The overall inhibition is length dependent, the longer the oligonucleotide the more effective the inhibition. The oligonucleotide Chi+ oligonucletides inhibit the activities of enzyme much more than do the oligonucleotides Chi0.
-
additional information
-
lambda Gam, by inhibiting host RecBCD nuclease activity, helps to improve the efficiency of lambda Red-mediated recombination with linear double-strand DNA
-
ACTIVATING COMPOUND
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
IMAGE
3',5'-cyclic AMP
-
less effective than ATP
5'-AMP
-
less effective than ATP
adenine
-
less effective than ATP
adenosine
-
less effective than ATP
ADP
-
less effective than ATP
Bovine serum albumin
-
2-3fold stimulation; required for endonuclaes activity
-
Bovine serum albumin
-
2-3fold stimulation
-
CTP
-
less effective than ATP
dATP
-
nearly as effective as ATP
dCTP
-
less effective than ATP
GTP
-
less effective than ATP
NaCl
-
ATP molecules hydrolyzed per base pair unwound slightly increased
RNA-DNA hybrid
-
activates ATPase only
-
S-adenosylmethionine
-
less effective than ATP
TTP
-
less effective than ATP
UTP
-
less effective than ATP
KM VALUE [mM]
KM VALUE [mM] Maximum
SUBSTRATE
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
IMAGE
134
-
34-mer ssDNA
-
25C
-
0.043
-
ATP
-
-
0.085
-
ATP
-
DNA-dependent ATPase activity
0.13
-
ATP
-
unwinding activity
0.048
-
dATP
-
-
1.3e-07
-
Double-stranded DNA
-
DNA-dependent ATPase activity
6e-07
-
Double-stranded DNA
-
unwinding activity
1e-06
-
Double-stranded DNA
-
-
315
-
ds-DNA
-
25C
-
0.007
-
oligonucleotide (polydT)8 polydA
-
-
-
TURNOVER NUMBER [1/s]
TURNOVER NUMBER MAXIMUM[1/s]
SUBSTRATE
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
IMAGE
1.4
-
34-mer ssDNA
-
25C
-
250
-
ATP
-
DNA-unwinding activity
740
-
ATP
-
DNA-dependent ATPase activity
3.7
-
ds-DNA
-
25C
-
additional information
-
additional information
-
The corrected unwinding rate is 443 base pairs 1/sec, which is due to a single molecule of enzyme that bound to the free double-stranded DNA end opposite the bead, and both translocates and unwinds the DNA in an ATP-dependent manner once the DNA entered the ATP channel. The rate of unwinding increases with increasing ATP concentration and increasing temperature
-
SPECIFIC ACTIVITY [µmol/min/mg]
SPECIFIC ACTIVITY MAXIMUM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
0.024
-
-
-
pH RANGE
pH RANGE MAXIMUM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
TEMPERATURE OPTIMUM
TEMPERATURE OPTIMUM MAXIMUM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
30
-
-
assay at
TEMPERATURE RANGE
TEMPERATURE MAXIMUM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
23
37
-
The rate of unwinding in 1 mM ATP increases twofold when the temperature is raised from 23C to 37C.
25
37
-
15000 base pairs of DNA per min at 25C; 55800 base pairs of DNA per min at 37C
30
43
-
pH 9.0, wild type, at 43C fourfold higher activity than at 30C
additional information
-
-
by altering the cultivation temperature (37C) of the cells to a moderately lower range (20-34C), dramatically reduces the linear DNA degradation activity of RecD
LOCALIZATION
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
GeneOntology No.
LITERATURE
SOURCE
PDB
SCOP
CATH
ORGANISM
Escherichia coli (strain K12)
Escherichia coli (strain K12)
MOLECULAR WEIGHT
MOLECULAR WEIGHT MAXIMUM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
58000
-
-
recD protein, gel filtration, SDS-PAGE
60000
-
-
recD protein, sedimentation, SDS-PAGE
66970
-
-
alpha subunit, recD protein, amino acid analysis
99000
-
-
sedimentation, calculated
134000
-
-
recB protein, amino acid analysis
220000
-
-
sedimentation, calculated
270000
-
-
gel filtration, SDS-PAGE
270000
-
-
-
270000
-
-
gel filtration, SDS-PAGE
308000
-
-
-
308000
-
-
gel filtration, SDS-PAGE
330000
-
-
-
333000
-
-
gel filtration, SDS-PAGE
350000
-
-
-
350000
-
-
sedimentation, calculated
655000
-
-
recB protein, gel filtration, glycerol gradient centrifugation
SUBUNITS
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
dimer
-
1 * 155000 + 1 * 140000, protease inhibitor phenylmethylsulfonyl flouride was added
dimer
-
1 * 140000 + 1 * 128000, dissociation by boiling, SDS-PAGE; 1 * 170000 + 1 * 60000, glycerol gradient sedimentation
dimer
-
1 * 140000 + 1 * 128000, dissociation by boiling, SDS-PAGE
dimer
-
1 * 135000 + 1 * 141000, addA and addB gene encode two subunits of enzyme, the enzyme carries two homologous nuclease domains
heterotrimer
-
RecB, RecC and RecD, The C-terminus of RecC: 35000 Da, is required for assembly of the RecD subunit into enzyme holoenzyme but not for recombination proficiency. The N-terminus of RecC: 95000 Da, contains functions essential for recombination and is also required for chi activity. RecD is essential for nuclease activity, regulation by the recombination hotspot Chi, and high affinity for DNA ends. RecC interacts with RecD to form a heterotrimer only in the presence of RecB.
heterotrimer
-
RecB, RecC and RecD subunits, The nuclease active site on the RecB 30000 Da domain is the universal nuclease active site of enzyme that is responsible for single-stranded DNA degradation in both directions.
pentamer
-
1 * 81000 + 1 * 70000 + 1 * 62000 + 1 * 52500 + 1 * 42500, no addition of protease inhibitor
trimer
-
1 * 115000 + 1 * 107000 + 1 * 68000
trimer
-
1 * 140000 + 1 * 130000 + 1 * 65000, SDS-PAGE
heterotrimer
-
complex of three RecB, RecC, RecD proteins
additional information
-
the difference between the AddAB and RecBCD enzymes is that the two enzyme have a very different subunit composition, the AddA subunit is a direct homologue of the RecB subunit, the helicases of each complex
Crystallization/COMMENTARY
ORGANISM
UNIPROT ACCESSION NO.
LITERATURE
vapour-diffusion hanging drop method, crystal structure of a complex of Escherichia coli RecBCD enzyme bound to ablunt-ended DNA hairpin
-
crystallisation of a Rec-B like nuclease by the sitting-drop vapour-diffusion method using polyethylene glycol 8000 as the precipitant. The crystals belong to the orthorhombic space group C222(1), with unit-cell parameters a = 81.5, b= 159.8, c = 100.8 A. There is a dimer in the asymmetric unit with its local twofold axis running parallel to the crystallographic twofold screw axis. The crystals diffract to about 2 A and a complete native data set is collected to 2.65 A resolution
Q9V2E8
TEMPERATURE STABILITY
TEMPERATURE STABILITY MAXIMUM
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
42
-
-
complete stable in presence of DNA for 40 min; faster inactivation in presence of ATP
GENERAL STABILITY
ORGANISM
UNIPROT ACCESSION NO.
LITERATURE
DNA stabilizes against thermal denaturation
-
RecBC enzyme more instable than the recBCD enzyme
-
stable during purification except steps requiring salt elution
-
STORAGE STABILITY
ORGANISM
UNIPROT ACCESSION NO.
LITERATURE
-20C, purified enzyme RecBC, 1 year, 80% loss of activity
-
-20C, purified enzyme RecBCD, 1 year, 10%-20% loss of activity
-
-20C, purified enzyme, 1 month, 35% loss of activity
-
-20C, purified enzyme, 7 months, 80% loss of activity
-
-70C, purified enzyme, 6 weeks, 0% loss of activity
-
0C, Tris, MgCl2, EDTA, mercaptoethanol, 1 d, 5-10% loss of activity
-
4C, RecC, stable for several months
-
Purification/COMMENTARY
ORGANISM
UNIPROT ACCESSION NO.
LITERATURE
to homogeneity
-
to homogeneity
-
of the abc-modified recBCD protein; of the mutant recB2109CD mutant
-
of the recombinant proteins B, C and D
-
RecC, RecBC and RecBCD, RecBC1041 mutant
-
wild-type and mutant enzyme
-
wild-type and mutant enzymes of RecB subunit: D1067A and K1082Q
-
Cloned/COMMENTARY
ORGANISM
UNIPROT ACCESSION NO.
LITERATURE
addA and addB
-
expression in Escherichia coli
-
fusion of the recBCD genes and expression in Escherichia coli
-
overexpression of RecBCD in Escherichia coli strain SCK387
-
recB protein
-
recC gene
-
RecD overproduction prevents dissociation of RscBCD enzyme from DNA substrate and increases its processivity
-
ENGINEERING
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
D1067A
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit abolishes nuclease activity on both single- and double-stranded DNA but the mutant enzyme is active as helicase. The mutant is unable to produce chi-specific fragments from either strand of a chi-containing double-stranded DNA substrate.
D1067A
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
D1080A
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
D1080A
-
Comparison: recB(D1080A)CD is recombinant-deficient, and sensitive to DNA damaging agents, and the purified enzyme failed to load RecA during DNA winding. recB(D1080A)C is recombinant-proficient and resistant to DNA damaging agents, and the mutant is active RecA loading assay.
K1082A
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
K1082Q
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit abolishes nuclease activity on both single- and double-stranded DNA but the mutant enzyme is active as helicase. The mutant is unable to produce chi-specific fragments from either strand of a chi-containing double-stranded DNA substrate.
Y1081A
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits substantial nuclease activity.
Y1081F
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits essentially wild-type levels of activity.
Y1114A
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits substantial nuclease activity.
Y1114F
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits essentially wild-type levels of activity.
D1067A
Escherichia coli K12
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
-
D1080A
Escherichia coli K12
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
-
K1082A
Escherichia coli K12
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
-
D1118A
-
site-directed mutagenesis, inactivation in the nuclease center of RecB
K229Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecD
D1118A
-
site-directed mutagenesis, inactivation in the nuclease center of RecB
-
K229Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecD
-
K177Q
-
involved in ATP binding site of the recD protein
additional information
-
recBC1010D, recBC1041D and recBCD1013 mutants have less than 0.2% of the exonuclease activity of wild-type enzyme. recBC1010D and recBC1041D produce RecD but fail to assemble it into holoenzyme
additional information
P08394
the mutant RecB2109CD degrades the double-stranded DNA primarily in the 5 to 3 direction, producing processed double-stranded DNA with a 3-terminal overhang, the mutant is unable to coordinate the loading of RecA protein onto the single-stranded DNA produced, this inability can be responsible for recB2109 recombination defect observed in vivo
additional information
-
RecB mutants that cannot bind or hydrolyze ATP are completely defective for DNA recombination
additional information
-
in mutants carrying either recB2109 or recD1903, which do not exhibit significant nuclease activities, the prophage progressively loses its capacity for both site-specific and general recombination
additional information
-
the recombination deficiency of the RecBC1004D-chi interaction can be overcome by the enhanced ability of RecA730 to assemble on single-stranded DNA in vitro and in vivo
K29Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecB
additional information
-
disruption of genes in the recCBD operon and creation of DELTArecC, DELTArecB, DELTArecD, and DELTArecCBD strains of Pseudomonas syringae Lz4W
K29Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecB
-
additional information
-
disruption of genes in the recCBD operon and creation of DELTArecC, DELTArecB, DELTArecD, and DELTArecCBD strains of Pseudomonas syringae Lz4W
-
APPLICATION
ORGANISM
UNIPROT ACCESSION NO.
COMMENTARY
LITERATURE
analysis
-
required for stability of plasmids
analysis
-
lack of enzyme increases transfection frequencies with linear DNA; possible role in genetic recombination
analysis
-
possible role in genetic recombination
analysis
-
cloning of palyndromic structures in the Physarum actin gene in E. coli lacking the recBC gene
analysis
-
no recombination in recB2109CD mutants; possible role in genetic recombination
analysis
-
recBCD inhibits recombination between closely related bacteria
additional information
-
AddA mutants that cannot bind or hydrolyze ATP are completely defective for DNA recombination