Information on EC 3.1.11.5 - exodeoxyribonuclease V

New: Word Map on EC 3.1.11.5
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Mark a special word or phrase in this record:
Search Reference ID:
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)


The expected taxonomic range for this enzyme is: Bacteria, Archaea, Eukaryota

EC NUMBER
COMMENTARY hide
3.1.11.5
-
RECOMMENDED NAME
GeneOntology No.
exodeoxyribonuclease V
REACTION
REACTION DIAGRAM
COMMENTARY hide
ORGANISM
UNIPROT
LITERATURE
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides
show the reaction diagram
REACTION TYPE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
DNA-dependent ATPase activity
-
-
-
-
hydrolysis of phosphoric ester
-
-
-
-
CAS REGISTRY NUMBER
COMMENTARY hide
37350-26-8
-
ORGANISM
COMMENTARY hide
LITERATURE
UNIPROT
SEQUENCE DB
SOURCE
strains JV28, KOM18, KOM45 and EK6
-
-
Manually annotated by BRENDA team
-
-
-
Manually annotated by BRENDA team
-
-
-
Manually annotated by BRENDA team
K12
-
-
Manually annotated by BRENDA team
Micrococcus luteus
-
-
Manually annotated by BRENDA team
three genes, recC, recB, and recD, in the recCBD operon
-
-
Manually annotated by BRENDA team
three genes, recC, recB, and recD, in the recCBD operon
-
-
Manually annotated by BRENDA team
-
SwissProt
Manually annotated by BRENDA team
yeast
-
-
Manually annotated by BRENDA team
sea urchin
-
-
Manually annotated by BRENDA team
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
malfunction
physiological function
SUBSTRATE
PRODUCT                       
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
34-mer ssDNA + H2O
?
show the reaction diagram
-
REcB30 binds more tightly on ssDNA than on dsDNA but is more active on dsDNA than on ssDNA
-
-
?
ATP + H2O
ADP + phosphate
show the reaction diagram
double-stranded DNA
3'-ended stretch of single-stranded DNA
show the reaction diagram
-
the enzyme is a ATP dependent helicase and exonuclease
-
?
double-stranded DNA
intermediates with single stranded regions
show the reaction diagram
double-stranded DNA
single stranged DNA
show the reaction diagram
-
unwinding of double-stranded DNA
substrate for the DNA strand-exchange protein, RecA, model for chi-induced RecA protein loading by RecBCD enzyme, substrate for the DNA strand-exchange protein, RecA
?
double-stranded DNA
single-stranded DNA
show the reaction diagram
-
ATP-dependent, unwinding of DNA molecule
-
?
double-stranded DNA
single-stranded DNA fragments
show the reaction diagram
double-stranded DNA + H2O
?
show the reaction diagram
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
douple-stranded DNA
?
show the reaction diagram
dsDNA + H2O
?
show the reaction diagram
-
REcB30 binds more tightly on ssDNA than on dsDNA but is more active on dsDNA than on ssDNA
-
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
additional information
?
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
ATP + H2O
ADP + phosphate
show the reaction diagram
double-stranded DNA
single stranged DNA
show the reaction diagram
-
unwinding of double-stranded DNA
substrate for the DNA strand-exchange protein, RecA
?
double-stranded DNA
single-stranded DNA
show the reaction diagram
-
ATP-dependent, unwinding of DNA molecule
-
?
double-stranded DNA
single-stranded DNA fragments
show the reaction diagram
double-stranded DNA + H2O
single-stranded DNA fragments
show the reaction diagram
douple-stranded DNA
?
show the reaction diagram
-
the enzyme is required for the major pathway of double-strand DNA break repair and genetic exchange, the enzyme has potent nuclease and helicase activity
-
?
single stranded DNA + H2O
5'-phosphomonoester oligonucleotides
show the reaction diagram
additional information
?
-
COFACTOR
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
Cd2+
-
inhibitory in the presence of Mg2+
Cu2+
-
slight activation of ssDNA nuclease activity of RecB30
Ni2+
-
slight activation of ssDNA nuclease activity of RecB30
Zn2+
-
slight activation of ssDNA nuclease activity of RecB30
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
abc protein
-
anti recBCD; binds the recBCD enzyme and inhibits recombination but not exonuclease activity; gamma-protein analog encoded by bacteriophage P22
-
bacteriophage Mu
-
induction of bacteriophage Mu causes inhibition of exonuclease V
-
d(GATCATTACTAGGCAGGTGG)
-
3'20-merChio
d(GATCATTACTAGGCTGGTGG)
-
3'20-merChi+
d(GATTAGGCaGGTGG)
-
3'14-merChio
d(GATTAGGCTGGTGG)
-
3'14-merChi+
d(GCAGGTGG)
-
8-merChio
d(GCAGGTGGGATCATTACTAG)
-
5'20-merChio
d(GCAGGTGGGATTAG)
-
5'14-merChio
d(GCTGGTGG)
-
8-merChi+
d(GCTGGTGGGATCATTACTAG)
-
5'20-merChi+
d(GCTGGTGGgattag)
-
5'14-merChi+
d(TACTAGGCaGGTGGGATCAT)
-
20-merChio
d(TACTAGGCTGGTGGGATCAT)
-
20-merChi+
d(TAGGCaGGTGGGAT)
-
14-merChio
d(TAGGCTGGTGGGAT)
-
14-merChi+
E. coli Bacteriophage proteins
-
-
-
E. coli single stranded DNA binding protein
Gamma-protein
pyridoxal 5'-phosphate
-
-
small DNA fragments
-
-
thermostable protein
-
-
-
additional information
ACTIVATING COMPOUND
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
3',5'-cyclic AMP
-
less effective than ATP
5'-AMP
-
less effective than ATP
adenine
-
less effective than ATP
adenosine
-
less effective than ATP
ADP
-
less effective than ATP
bovine serum albumin
CTP
-
less effective than ATP
dATP
-
nearly as effective as ATP
dCTP
-
less effective than ATP
GTP
-
less effective than ATP
NaCl
-
ATP molecules hydrolyzed per base pair unwound slightly increased
RNA-DNA hybrid
-
activates ATPase only
-
S-adenosylmethionine
-
less effective than ATP
TTP
-
less effective than ATP
UTP
-
less effective than ATP
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
134
34-mer ssDNA
-
25C
-
0.043 - 0.15
ATP
0.048
dATP
-
-
0.00000013 - 0.000001
Double-stranded DNA
315
ds-DNA
-
25C
-
0.007
oligonucleotide (polydT)8 polydA
-
-
-
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
1.4
34-mer ssDNA
Escherichia coli
-
25C
-
250 - 740
ATP
3.7
ds-DNA
Escherichia coli
-
25C
-
additional information
additional information
Escherichia coli
-
The corrected unwinding rate is 443 base pairs 1/sec, which is due to a single molecule of enzyme that bound to the free double-stranded DNA end opposite the bead, and both translocates and unwinds the DNA in an ATP-dependent manner once the DNA entered the ATP channel. The rate of unwinding increases with increasing ATP concentration and increasing temperature
-
SPECIFIC ACTIVITY [µmol/min/mg]
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
pH RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
30
-
assay at
TEMPERATURE RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
23 - 37
-
The rate of unwinding in 1 mM ATP increases twofold when the temperature is raised from 23C to 37C.
25 - 37
-
15000 base pairs of DNA per min at 25C; 55800 base pairs of DNA per min at 37C
30 - 43
-
pH 9.0, wild type, at 43C fourfold higher activity than at 30C
additional information
-
by altering the cultivation temperature (37C) of the cells to a moderately lower range (20-34C), dramatically reduces the linear DNA degradation activity of RecD
LOCALIZATION
ORGANISM
UNIPROT
COMMENTARY hide
GeneOntology No.
LITERATURE
SOURCE
PDB
SCOP
CATH
ORGANISM
UNIPROT
Escherichia coli (strain K12)
Escherichia coli (strain K12)
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
58000
-
recD protein, gel filtration, SDS-PAGE
60000
-
recD protein, sedimentation, SDS-PAGE
66970
-
alpha subunit, recD protein, amino acid analysis
99000
-
sedimentation, calculated
134000
-
recB protein, amino acid analysis
220000
-
sedimentation, calculated
270000
308000
333000
-
gel filtration, SDS-PAGE
350000
655000
-
recB protein, gel filtration, glycerol gradient centrifugation
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
heterotrimer
pentamer
-
1 * 81000 + 1 * 70000 + 1 * 62000 + 1 * 52500 + 1 * 42500, no addition of protease inhibitor
trimer
additional information
-
the difference between the AddAB and RecBCD enzymes is that the two enzyme have a very different subunit composition, the AddA subunit is a direct homologue of the RecB subunit, the helicases of each complex
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
vapour-diffusion hanging drop method, crystal structure of a complex of Escherichia coli RecBCD enzyme bound to ablunt-ended DNA hairpin
-
crystallisation of a Rec-B like nuclease by the sitting-drop vapour-diffusion method using polyethylene glycol 8000 as the precipitant. The crystals belong to the orthorhombic space group C222(1), with unit-cell parameters a = 81.5, b= 159.8, c = 100.8 A. There is a dimer in the asymmetric unit with its local twofold axis running parallel to the crystallographic twofold screw axis. The crystals diffract to about 2 A and a complete native data set is collected to 2.65 A resolution
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
42
-
complete stable in presence of DNA for 40 min; faster inactivation in presence of ATP
GENERAL STABILITY
ORGANISM
UNIPROT
LITERATURE
DNA stabilizes against thermal denaturation
-
RecBC enzyme more instable than the recBCD enzyme
-
stable during purification except steps requiring salt elution
-
STORAGE STABILITY
ORGANISM
UNIPROT
LITERATURE
-20C, purified enzyme RecBC, 1 year, 80% loss of activity
-
-20C, purified enzyme RecBCD, 1 year, 10%-20% loss of activity
-
-20C, purified enzyme, 1 month, 35% loss of activity
-
-20C, purified enzyme, 7 months, 80% loss of activity
-
-70C, purified enzyme, 6 weeks, 0% loss of activity
-
0C, Tris, MgCl2, EDTA, mercaptoethanol, 1 d, 5-10% loss of activity
-
4C, RecC, stable for several months
-
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
of the abc-modified recBCD protein; of the mutant recB2109CD mutant
-
of the recombinant proteins B, C and D
-
partial
RecC, RecBC and RecBCD, RecBC1041 mutant
-
to homogeneity
wild-type and mutant enzyme
-
wild-type and mutant enzymes of RecB subunit: D1067A and K1082Q
-
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
addA and addB
-
expression in Escherichia coli
-
fusion of the recBCD genes and expression in Escherichia coli
-
overexpression of RecBCD in Escherichia coli strain SCK387
-
recB protein
-
recC gene
-
RecD overproduction prevents dissociation of RscBCD enzyme from DNA substrate and increases its processivity
-
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
D1067A
D1080A
K1082A
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
K1082Q
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit abolishes nuclease activity on both single- and double-stranded DNA but the mutant enzyme is active as helicase. The mutant is unable to produce chi-specific fragments from either strand of a chi-containing double-stranded DNA substrate.
K177Q
-
involved in ATP binding site of the recD protein
Y1081A
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits substantial nuclease activity.
Y1081F
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits essentially wild-type levels of activity.
Y1114A
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits substantial nuclease activity.
Y1114F
-
The mutation in the carboxyl-terminal nuclease domain of the RecB subunit exhibits essentially wild-type levels of activity.
D1067A
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
-
D1080A
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
-
K1082A
-
chi is not a hot-spot for recombination in the mutant, the mutant is sligthtly defective for recombinational repair
-
D1118A
-
site-directed mutagenesis, inactivation in the nuclease center of RecB
K229Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecD
K29Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecB
D1118A
-
site-directed mutagenesis, inactivation in the nuclease center of RecB
-
K229Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecD
-
K29Q
-
site-directed mutagenesis, inactivation of the ATPase active site of RecB
-
additional information
APPLICATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
analysis
additional information
-
AddA mutants that cannot bind or hydrolyze ATP are completely defective for DNA recombination
Show AA Sequence (10413 entries)
Longer loading times are possible. Please use the Sequence Search for a certain query.