Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 3.1.11.5 extracted from

  • Kulkarni, A.; Julin, D.A.
    Specific inhibition of the E.coli RecBCD enzyme by Chi sequences in single-stranded oligodeoxyribonucleotides (2004), Nucleic Acids Res., 32, 3672-3682.
    View publication on PubMedView publication on EuropePMC

Inhibitors

Inhibitors Comment Organism Structure
d(GATCATTACTAGGCAGGTGG) 3'20-merChio Escherichia coli
d(GATCATTACTAGGCTGGTGG) 3'20-merChi+ Escherichia coli
d(GATTAGGCaGGTGG) 3'14-merChio Escherichia coli
d(GATTAGGCTGGTGG) 3'14-merChi+ Escherichia coli
d(GCAGGTGG) 8-merChio Escherichia coli
d(GCAGGTGGGATCATTACTAG) 5'20-merChio Escherichia coli
d(GCAGGTGGGATTAG) 5'14-merChio Escherichia coli
d(GCTGGTGG) 8-merChi+ Escherichia coli
d(GCTGGTGGGATCATTACTAG) 5'20-merChi+ Escherichia coli
d(GCTGGTGGgattag) 5'14-merChi+ Escherichia coli
d(TACTAGGCaGGTGGGATCAT) 20-merChio Escherichia coli
d(TACTAGGCTGGTGGGATCAT) 20-merChi+ Escherichia coli
d(TAGGCaGGTGGGAT) 14-merChio Escherichia coli
d(TAGGCTGGTGGGAT) 14-merChi+ Escherichia coli
additional information The overall inhibition is length dependent, the longer the oligonucleotide the more effective the inhibition. The oligonucleotide Chi+ oligonucletides inhibit the activities of enzyme much more than do the oligonucleotides Chi0. Escherichia coli

Organism

Organism UniProt Comment Textmining
Escherichia coli
-
-
-

Reaction

Reaction Comment Organism Reaction ID
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides The enzyme generates 3’ single-stranded DNA ends used by RecA for homologous recombination. The exonuclease activity is altered when the enzyme encounters a Chi sequence, 5’-GCTGGTGG-3’, in double-stranded DNA, an event critical to generation of 3’ single-stranded DNA. Chi recognition requires that Chi be flanked by DNA at either end. A specific site for Chi recognition exists on enzyme, which binds Chi with greater affinity than a non-Chi sequence and is probably adjacent to non-specific DNA binding sites. Escherichia coli

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
double-stranded DNA the enzyme is a ATP dependent helicase and exonuclease Escherichia coli 3'-ended stretch of single-stranded DNA
-
?