Information on EC 3.1.99.B1 - flap endonuclease-1

Word Map on EC 3.1.99.B1
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)

The enzyme appears in viruses and cellular organisms

EC NUMBER
COMMENTARY hide
3.1.99.B1
preliminary BRENDA-supplied EC number
RECOMMENDED NAME
GeneOntology No.
flap endonuclease-1
-
REACTION
REACTION DIAGRAM
COMMENTARY hide
ORGANISM
UNIPROT
LITERATURE
endonucleases that remove 5' DNA sequences from a DNA structure called a DNA flap. The DNA flap structure occurs in double-stranded DNA containing a single-stranded break where the 5' portion of the downstream strand is too long and overlaps the 3' end of the upstream strand. Flap endonucleases cleave the downstream strand of the overlap flap structure precisely after the first base-paired nucleotide, creating a ligatable nick.
show the reaction diagram
-
-
-
-
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
physiological function
-
the structure-specific nuclease is involved in DNA replication and repair. In DNA replication the enzyme removes the RNA primer of the lagging strand synthesis. In DNA repair, FEN-1 eliminates the damaged DNA and maintains genome integrity by preventing repeat sequence expansion. It recognizes branched structures containing single unpaired ssDNA (flap). Both the 3'-flap and 5'-flap are recognized by the enzyme and the 5'-flap region is excised. The product is a nicked duplex, which is subsequently sealed by DNA ligase
SUBSTRATE
PRODUCT                       
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
5'-FAM-pd(CGCTGTCGAACACACGCTTGCGTGTGTTC) + H2O
?
show the reaction diagram
-
5'-overhanging hairpin substrate
-
-
?
DNA + H2O
?
show the reaction diagram
flap DNA + H2O
?
show the reaction diagram
M13mp18 circular ssDNA + H2O
?
show the reaction diagram
-
-
-
-
?
Phi X174 circular ssDNA + H2O
?
show the reaction diagram
-
-
-
-
?
additional information
?
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
DNA + H2O
?
show the reaction diagram
flap DNA + H2O
?
show the reaction diagram
additional information
?
-
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
Ca2+
-
at pH 9.3, Ca2+substantially stabilizes both complexes, wild-type-substrate and D201I/D204S-substrate complexes, but calcium ions do not support FEN catalysis and inhibit the reactions supported by viable metal cofactors
K+
-
monovalent salt effect is broad, with equal activities observed in 50 and 100 mM KCl
KCl
-
60 mM, the activity increases 1.3-fold, 100 mM KCl result in significant inhibition of activity
Sm3+
-
in the active site, the 5'-monophosphate of the cleaved product nt (-1) is coordinated by two Sm3+ ions. Sm1 is coordinated by Asp86, Glu160, and two oxygens of the cleaved 5'-monophosphate. Sm2 is coordinated by Glu160, Asp179, Asp181 and one phosphate oxygen. Asp34, Glu158, and Asp233 interact with Sm3+ via waters
additional information
-
M2 is not involved in chemical catalysis but plays a role in substrate binding, and thus a two-metal ion mechanism is plausible. Metallonucleases are often assigned a two-metal ion mechanism where both metals contact the scissile phosphate diester, modeling of the reaction requiring the presence of two ions that are bound independently, overview
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
3-hydroxy-5-methyl-1-phenylthieno[2,3-d]pyrimidine-2,4(1H,3H)-dione
-
i.e. PTPD
ATP
-
inhibits the flap endo/exonuclease activity of Dna2
aurintricarboxylic acid
-
-
EDTA
-
5 mM, complete inhibition
KCl
-
60 mM, the activity increases 1.3-fold, 100 mM KCl result in significant inhibition of activity
Mg2+
-
addition of 1 mM MgCl2 increases the activity 1.4-fold. 10 mM MgCl2 results in greater than 90% inhibition
Mn2+
-
addition of 0.1 mM MgCl2 increases the activity 1.5-fold. 10 mM MnCl2 results in greater than 90% inhibition
NSC-13744
-
an arylstibonic inhibitor
NSC-13755
-
an arylstibonic inhibitor
NSC-13793
-
an arylstibonic inhibitor
NSC-15596
-
an arylstibonic inhibitor
additional information
-
ACTIVATING COMPOUND
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
additional information
-
a telomeric tail, but not a polyA tail, stimulates hFEN1 excision on the opposite strand
-
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
additional information
additional information
-
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
additional information
additional information
-
kcat/KM VALUE [1/mMs-1]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
additional information
additional information
2
IC50 VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
0.000022 - 0.000036
3-hydroxy-5-methyl-1-phenylthieno[2,3-d]pyrimidine-2,4(1H,3H)-dione
0.00054 - 0.00063
aurintricarboxylic acid
0.13 - 0.16
NSC-13744
0.00066 - 0.0012
NSC-13755
0.0017
NSC-13793
Homo sapiens
-
fluorogenic assay and chemoluminescence assay, 22°C, pH not specified in the publication
0.012 - 0.018
NSC-15596
pH OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
7.4
-
assay at
7.6
-
assay at
8
-
assay at
9.3
-
Mg2+-supported reaction
pH RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
5 - 9.5
5 - 9
enzyme form StolL-FEN-1 exhibits activity in the pH-range 5-9
5.7 - 9.5
-
pH 7.7: 77% of maximal activity, pH 9.5: 91% of maximal activity
6 - 8
-
pH 6.0-7.0: optimum, pH 8.0: about 55% of maximal activiy
6 - 7
-
the activity of phFEN decreases immediately at pH values below 6.0 and over 7.0. The activity can not be detected at pH 5.0 and decreased to 24% at pH 9.4
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
22
-
assay at room temperature
additional information
-
the optimal temperature could not be determined since the activity peak could not be detected
TEMPERATURE RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
35
-
enzyme begins to show activity at temperatures above 35 °C
50 - 80
-
about 50% of maximal activity, 80°C: about 65% of maximal activity
pI VALUE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
additional information
-
the pI value of the phFEN is greater than 9.3
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
monomer
-
1 * 41000, SDS-PAGE
additional information
-
the FEN1 structure shows the helical clamp and the flexible loop of archaeal enzymes, which exhibits a putative substrate-binding pocket with a unique conformation, three-dimensional structure analysis, overview
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
hanging-drop vapour diffusion
-
crystal structure of the enzyme bound to dsDNA
-
2.0 A resolution; FEN1, X-ray diffraction structure determination and analysis at 2.0 A resolution
-
sitting-drop vapour-diffusion method with monoammonium dihydrogen phosphate as the precipitant at pH 8.3. X-ray diffraction data are collected to 2.0 A resolution
-
purified recombinant His-tagged FEN1 mutant DELTA 336 and FEN1 mutant DELTA 336 D181A, X-ray diffraction structure determination and analysis
-
crystals are grown at 7°C by hanging drop vapor diffusion method, crystal structure of FEN-1 from Methanococcus jannaschii, determined at 2.0 A resolution, reveals an active site with two metal ions residing on top of a deep cleft where several conserved acidic residues are clustered. Near the active site, a long flexible loop comprised of many basic and aromatic residues forms a hole large enough to accommodate the DNA substrate
-
the crystal belongs to the space group of P2(1) with unit cell dimensions of a = 58.93 A, b = 42.53 A, c = 62.62 A and beta = 92.250, 2.0 A resolution, frozen crystal
-
hanging drop vapor diffusion, crystal structure at 2.0 A resolution
-
hanging-drop vapor diffusion, the crystal structure of flap endonuclease-1 from Pyrococcus horikoshii (phFEN-1) is determined to a resolution of 3.1 A
-
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
80
15 min, stable
100
complete inactivation
102
-
Tm-value is 102°C in 0.0085 and 0.0014 mM protein with 1 M NaCl concentrations. Values of Tm are not dependent on the protein concentration
additional information
STORAGE STABILITY
ORGANISM
UNIPROT
LITERATURE
-20°C, in 50% glycerol solution
4°C or 20°C, stable for over 3 months without loss of activity
-
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
recombinant His-tagged FEN1 from Escherichia coli strain BL21 (DE3)/pLysS
-
recombinant His6-tagged FEN1 mutant DELTA 336 and FEN1 mutant DELTA 336 D181A from Escherichia coli
-
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
expressed in Escherichia coli
-
expression in Escherichi coli
expression in Escherichia coli
expression of His6-tagged FEN1 mutant DELTA 336 and FEN1 mutant DELTA 336 D181A in Escherichia coli
-
overexpressed in Escherichia coli
-
overexpression of His-tagged FEN1 in Escherichia coli strain BL21 (DE3)/pLysS
-
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
D201I/D204S
-
site-directed mutagenesis, the overall reaction catalyzed by mutant D201I/D204S required two Mg2+ ions, in contrast to the wild-type enzyme that requires 3 Mg2+. D201I/D204S T5FENs is biphasic with respect to Ca2+ and ultimately dependent on 1/[Ca2+]2
D181A
-
construction of a FEN1 mutant DELTA 336 truncated after residue 336 that bears an additional point mutation at residue 181. FEN1 DELTA336 removes only the flexible, protruding PCNA binding motif and encompasses the entire catalytic domain, and the active site D181A mutation severely retards incision. The DNA contains competing base pairing purine-pyrimidine pairs at the DNA junction, but the C-A mismatch favors 1 nt 3' flap formation
F278A/F279A
-
the kcat values of the mutant enzyme are decreased about 10–20% with the 5'-recess-end substrate and the nick substrate
F278H/F279H
-
kcat value decreases 83fold for the 5'-recess-end substrate and 150fold for the nick substrate compared with the wild-type values. 454fold decrease in kcat/Km for the 5'-recess-end substrate, 80fold decrease in kcat/Km for the nick substrate. The Km-value for the endo activity with the double flap substrate is increased 4fold, the kcat/Km-value is decreased 14fold, compared with the wild-type value; the Km value for the 5'-recess-end substrate is elevated 5 times compared with the wild-type value whereas for the nick substrate the Km value of F278H/F279H is 60% the wild-type value
F278L/F279L
-
Km-values are lower than the wild-type values; the kcat values of the mutant enzyme are decreased about 10–20% with the 5'-recess-end substrate and the nick substrate
F278W/F279W
-
Km-values are lower than the wild-type values; the kcat values of the mutant enzyme are decreased about 10–20% with the 5'-recess-end substrate and the nick substrate
F278Y/F279Y
-
Km-values are lower than the wild-type values; the kcat value of F278Y/F279Y is restored to around 70% of that of wil-type enzyme with the 5'-recess-end substrate and the nick substrate
F35A
-
kcat and Km of F35A and F35L show no significant decrease compared with the wild-type values
F35L
-
kcat and Km of F35A and F35L show no significant decrease compared with the wild-type values
F35Y
-
the Km values of the mutant enzyme are about 4- and 3fold higher than the values of wild-type enzyme with the nick and 5'-recess-end substrates, respectively
F79A
-
for the 5'-recess-end substrate, the kcat value of the mutant enzyme decreases 71fold compared with that of wild-type.For the nick substrate, the kcat value decreases 25fold compared with that of wild-type. 58fold decrease in kcat/Km for the 5'-recess-end substrate, 75fold decrease in kcat/Km for the nick substrate. The Km-value for the endo activity with the double flap substrate is increased 7fold, the kcat/Km-value is decreased 6fold, compared with the wild-type value.For the single flap and pseudo-Y substrates, the kcat of F79A decreases 31- and 37fold, respectively, compared with that of wild-type
F79H
-
te kcat value of the mutant for the 5'-recess-end substrate is decreased to about 50% of the wild-type value, and the kcat value of F79H for the nick substrate is seven times lower than that of wild-type enzyme. The Km value of F79H for the 5'-recess-end substrate is 13fold higher than that of wild-type, whereas the Km value of F79H for the nick substrate is about 2 times higher than that of wild-type
F79L
-
for the 5'-recess-end substrate, the kcat value of the mutant enzyme is restored to 20% of the wild-type value.For the nick substrate, the kcat value of the mutant enzyme is restored to 20% of that of the wild-type enzyme. The kcat-values for of the single flap and pseudo-Y substrates decrease to 17 and 7% of the wild-type values, respectively. The Km for the single flap and pseudo-Y substrates is varied moderately, but not significantly, compared with that of wild-type enzyme
F79W
-
the kcat values of the mutant enzyme for the 5'-recess-end substrate and the nick substrate are restored to almost the same level as the wild-type values
F79Y
-
the kcat values of the mutant enzyme for the 5'-recess-end substrate and the nick substrate are restored to almost the same level as the wild-type values. The kcat-value for the single flap and pseudo-Y substrates are restored to almost the same level as the wild-type substrates
K193A
-
KM-value is 4fold of the wild-type value, kcat is almost the same as for wild-type enzyme
K193A/R194A/K195A
-
kcat/Km-value is decreased 76fold, compared with the value of wild-type enzyme; the Km value of the mutant enzyme increases markedly and the kcat value decreases moderately
K193E/R194E/K195E
-
the negatively charged triple mutant shows similar but more magnified effects on both parameters compared with the alanine triple mutant K193A/R194A/K195A
K195A
-
KM-value is 8fold of the wild-type value, kcat is almost the same as for wild-type enzyme
K199A
-
km and kcat values of the mutant enzyme differ little from the wild-type values
K243A
-
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K243E
-
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K248A
-
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K249A
-
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K263A
-
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K263E
-
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K51E/R53E
-
the double mutant retains 30% of the wild-type kcat/Km value
K87A
-
the kcat value of the mutant decreased 400fold, whereas the Km value is almost the same as that of wild-type enzyme
K87A/R88A/K89A
-
the Km-value is 5fold higher, the kcat is 184fold lower than that of the wild-type enzyme
K93A/R94A/R95A
-
Km-value and kcat-value is increased 17fold and decreased 96fold, respectively, compared with the wild-type values
L47F
-
Km-value is similat to the value of the wild-type
L47G
-
Km value of the mutant is increased 20fold
R118A/K119A
-
kcat/Km-value is decreased 1851fold, compared with the value of wild-type enzyme; kcat-value is decreased 111fold, compared with the wild-type value; KM-value is magnified by 17fold
R194A
-
KM-value is 5fold of the wild-type value, kcat is almost the same as for wild-type enzyme
R40E/R42E
-
the Km of the mutynt is increased 105fold compared with wild-type. The kcat and kcat/Km values areo decreased 4- and 680fold, respectively
R40G
-
Km of the mutant increases 7fold, compared with that of the wild-type enzyme
R40G/R42G
-
kcat/Km-value is decreased 222fold, compared with the value of wild-type enzyme; KM-value is magnified by 6fold; Km-value of the mutant enzyme is elevated 26fold compared with that of the wild type
R40Q
-
Km value of the single mutant enzyme increases 10fold
R42E
-
Km and kcat/Km values of the mutant are 19fold higher and 25fold lower than the values of wild-type enzyme, respectively
R42G
-
Km of the mutant increases 7fold, compared with that of the wild-type enzyme
R42Q
-
KM-value is almost the same as the value for wild-type enzyme
R88A
-
Km and kcat values of the mutant enzyme do not change markedly, compared with the wild-type values
R89A
-
Km and kcat values of the mutant enzyme do not change markedly, compared with the wild-type values
R94A
-
kcat-value is decreased 200fold compared with the wild-type value; mutant enzyme shows a 12fold increase in the Km value and a 15fold decrease in the kcat-value compared with the wild-type values
Y237A
-
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
Y33A
-
kcat decreases 333fold, compared with that of the wild-type enzyme, for exo-activity against the 5'-recess-end substrate. For the exo-activity against the nick substrate, the kcat values decreases 53fold.The kcat of Y33A for the single flap substrate decreases 30fold. The kcat of Y33A for the pseudo-Y substrate decreases 485fold
Y33F
-
kcat for exo-activity against the 5'-recess-end substrate is 20-30% of the wild-type value. The kcat values of Y33F for the single flap and pseudo-Y substrates are restored to 38 and 20% of the value of wild-type, respectively
Y33H
-
kcat for exo-activity against the 5'-recess-end substrate is 20-30% of the wild-type value
Y33L
-
kcat decreases 1180fold, compared with that of the wild-type enzyme, for exo-activity against the 5'-recess-end substrate. For the exo-activity against the nick substrate, the kcat values decreases 134fold. 2353fold decrease in kcat/Km for the 5'-recess-end substrate, 270fold decrease in kcat/Km for the nick substrate. The Km-value for the endo activity with the double flap substrate is increased 4fold, the kcat/Km-value is decreased 5fold, compared with the wild-type value. The kcat of Y33A for the single flap substrate decreases 433fold. The kcat of Y33A for the pseudo-Y substrate decreases 3233fold
Y33W
-
kcat for exo-activity against the 5'-recess-end substrate is 20-30% of the wild-type value
APPLICATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
drug development
-
inhibitors of the enzyme carry a potential as enhancers of DNA-interactive anticancer drugs