Any feedback?
Please rate this page
(search_result.php)
(0/150)

BRENDA support

Refine search

Search Substrates and Products (Substrate)

show results
Don't show organism specific information (fast!)
Search organism in taxonomic tree (slow, choose "exact" as search mode, e.g. "mammalia" for rat,human,monkey,...)
(Not possible to combine with the first option)
Refine your search

Search term:

<< < Results 171 - 176 of 176
EC Number Substrates Commentary Substrates Organism Products Commentary (Products) Reversibility
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + 5'-d(GCCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3' 100% ligation efficiency Thermus aquaticus ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + 5'-d(GCCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3' 100% ligation efficiency Tequatrovirus T4 ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + deoxyribonucleotide - Streptococcus pneumoniae AMP + nicotinamide nucleotide + (deoxyribonucleotide)n+m - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + deoxyribonucleotide - Wolbachia endosymbiont of Brugia malayi AMP + nicotinamide nucleotide + (deoxyribonucleotide)n+m - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NADH + (deoxyribonucleotide)n + (deoxyribonucleotide)m NADH has a significantly higher Km as NAD+ Escherichia coli ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2Thionicotinamide derivative of NAD+ + (deoxyribonucleotide)n + (deoxyribonucleotide)m significantly higher Km as NAD+ Escherichia coli ? - ?
<< < Results 171 - 176 of 176