Any feedback?
Please rate this page
(search_result.php)
(0/150)

BRENDA support

Refine search

Search Substrates and Products (Substrate)

show results
Don't show organism specific information (fast!)
Search organism in taxonomic tree (slow, choose "exact" as search mode, e.g. "mammalia" for rat,human,monkey,...)
(Not possible to combine with the first option)
Refine your search

Search term:

<< < Results 161 - 170 of 176 > >>
EC Number Substrates Commentary Substrates Organism Products Commentary (Products) Reversibility
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Haemophilus influenzae ARM158 (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Escherichia coli ARC524 (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Streptococcus pneumoniae ATCC 10813 (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Mycobacterium tuberculosis H37Rv (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Wolbachia sp. subsp. Brugia malayi TRS (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Streptococcus pneumoniae ARC548 (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Staphylococcus aureus ATCC 29213 (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m - Staphylococcus aureus ARC561 (deoxyribonucleotide)n+m + AMP + beta-nicotinamide D-nucleotide - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + 5'-d(ACCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3' 100% ligation efficiency Thermus aquaticus ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 6.5.1.2NAD+ + 5'-d(ACCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3' 100% ligation efficiency Tequatrovirus T4 ? - ?
<< < Results 161 - 170 of 176 > >>