Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 3.6.1.59 extracted from

  • Wulf, M.G.; Buswell, J.; Chan, S.H.; Dai, N.; Marks, K.; Martin, E.R.; Tzertzinis, G.; Whipple, J.M.; Correa, I.R.; Schildkraut, I.
    The yeast scavenger decapping enzyme DcpS and its application for in vitro RNA recapping (2019), Sci. Rep., 9, 8594 .
    View publication on PubMedView publication on EuropePMC
Search for more literature for 3.6.1.59

Cloned(Commentary)

Cloned (Comment) Organism
expressed in Escherichia coli ER3600 cells Saccharomyces cerevisiae

Inhibitors

Inhibitors Comment Organism Structure
KCl the decapping reaction is significantly inhibited by increasing salt concentration, with KCl being a more potent inhibitor than NaCl Saccharomyces cerevisiae
NaCl the decapping reaction is significantly inhibited by increasing salt concentration, with KCl being a more potent inhibitor than NaCl Saccharomyces cerevisiae

Metals/Ions

Metals/Ions Comment Organism Structure
additional information the enzyme is independent of divalent metal ions Saccharomyces cerevisiae

Natural Substrates/ Products (Substrates)

Natural Substrates Organism Comment (Nat. Sub.) Natural Products Comment (Nat. Pro.) Rev. Reac.
a 5'-(N7-methyl 5'-triphosphoguanosine)-[mRNA] + H2O Saccharomyces cerevisiae the enzyme decaps RNA transcripts as long as 1400 nucleotides N7-methylguanosine 5'-phosphate + a 5'-diphospho-[mRNA]
-
 ?

Organism

Organism UniProt Comment Textmining
Saccharomyces cerevisiae
-
-
-

Purification (Commentary)

Purification (Comment) Organism
HisTrap, SP, and Q resin column chromatography Saccharomyces cerevisiae

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
5'-[GpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[GpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[GpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[GpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7AraGpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7AraGpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7AraGpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7AraGpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7dGpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7dGpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7dGpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7dGpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GppPAm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GpppCm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GpppGm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7Gpppm6Am]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7Gpppm6A]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GpppUm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7GpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
5'-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O the substrate is 95% decapped at 0.0027 mM enzyme Saccharomyces cerevisiae ?
-
 ?
a 5'-(N7-methyl 5'-triphosphoguanosine)-[mRNA] + H2O the enzyme decaps RNA transcripts as long as 1400 nucleotides Saccharomyces cerevisiae N7-methylguanosine 5'-phosphate + a 5'-diphospho-[mRNA]
-
 ?
additional information the enzyme can decap most guanosine caps. In contrast, it shows no activity towards adenosine, cytidine or uridine capped RNAs Saccharomyces cerevisiae ?
-
-

Synonyms

Synonyms Comment Organism
Dcps
-
 Saccharomyces cerevisiae
Dcs1
-
 Saccharomyces cerevisiae
scavenger mRNA decapping enzyme
-
 Saccharomyces cerevisiae