cytoskeleton-based apparatus to drive chromosome segregation consisting of two interacting proteins, SegA and SegB. SegA is an ATPase that polymerizes in vitro and SegB is a site-specific DNA-binding protein contacting palindromic sequences located upstream of the segAB cassette. SegB interacts with SegA in the presence of nucleotides and dramatically affects its polymerization dynamics. SegB strongly stimulates SegA polymerization, possibly by promoting SegA nucleation and accelerating polymer growth. The SegAB complex fulfills a crucial function in chromosome segregation
cytoskeleton-based apparatus to drive chromosome segregation consisting of two interacting proteins, SegA and SegB. SegA is an ATPase that polymerizes in vitro and SegB is a site-specific DNA-binding protein contacting palindromic sequences located upstream of the segAB cassette. SegB interacts with SegA in the presence of nucleotides and dramatically affects its polymerization dynamics. SegB strongly stimulates SegA polymerization, possibly by promoting SegA nucleation and accelerating polymer growth. The SegAB complex fulfills a crucial function in chromosome segregation
Substrates: SegA binds DNA either in the absence or in the presence of ATP. The binding affinity of SegA for the 23-bp S1 DNA (F: TACGTAGAAGAGTCTAGACTGAC) is 1.3 microM in the absence of nucleotide, and is 0.21 and 0.47 microM in the presence of ATP and ADP, respectively Products: -
Substrates: cytoskeleton-based apparatus to drive chromosome segregation consisting of two interacting proteins, SegA and SegB. SegA is an ATPase that polymerizes in vitro and that SegB is a site-specific DNA-binding protein contacting palindromic sequences located upstream of the segAB cassette. SegB interacts with SegA in the presence of nucleotides and dramatically affects its polymerization dynamics. SegB strongly stimulates SegA polymerization, possibly by promoting SegA nucleation and accelerating polymer growth. The SegAB complex fulfills a crucial function in chromosome segregation Products: -
Substrates: cytoskeleton-based apparatus to drive chromosome segregation consisting of two interacting proteins, SegA and SegB. SegA is an ATPase that polymerizes in vitro and that SegB is a site-specific DNA-binding protein contacting palindromic sequences located upstream of the segAB cassette. SegB interacts with SegA in the presence of nucleotides and dramatically affects its polymerization dynamics. SegB strongly stimulates SegA polymerization, possibly by promoting SegA nucleation and accelerating polymer growth. The SegAB complex fulfills a crucial function in chromosome segregation Products: -
SegC interacts directly with both SegA and SegB and filament dynamics are likely regulated through those interactions. SegA remodels these filaments into having a larger diameter in the presence of ATP. SegB can modulate the properties of these fila ments, likely by promoting the ATPase activity of SegA
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
CRYSTALLIZATION (Commentary)
ORGANISM
UNIPROT
LITERATURE
structure of apo protein and in complex with DNA. SegA forms an atypical, novel non-sandwich dimer that binds DNA either in the presence or in the absence of ATP. The unstructured DNA-binding protein SegB N-terminus plays an essential catalytic role in stimulating SegA ATPase activity and an architectural regulatory role in segrosome (SegA-SegB-DNA) formation
show
top
