EC Number   |
Substrates |
Organism |
Products |
Reversibility |
|---|
   4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the enzyme controls the expression of a number of phage early genes. It cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site |
Tequatrovirus T4 |
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the enzyme is necessary for the degradation of early but not middle or late mRNAs. The synthesis of several early proteins is down-regulated, probably as a consequence of RegB cleavages in the Shine-Dalgarno sequence of these genes. The synthesis of several other proteins is up-regulated, suggesting that processing by RegB might improve translation by changing the conformation of a transcript |
Tequatrovirus T4 |
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the enzyme participates in the bacteriophage T4 life cycle by favoring early messenger RNA breakdown. It specifically cleaves GGAG sequences found in intergenic regions, mainly in translation initiation sites |
Tequatrovirus T4 |
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the enzyme cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site. It produces a cyclic 2',3'-phosphodiester product |
Tequatrovirus T4 |
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the enzyme cleaves early mRNAs between Ap and Gp at one specific specific GpGpApGp site. Many intergenic GGAG motifs, including Shine-Dalgarno sequences, are not substrates for RegB |
Tequatrovirus T4 |
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the enzyme specifically cleaves GGAG sequences found in intergenic regions, mainly in translation initiation sites |
Tequatrovirus T4 |
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
- |
Tequatrovirus T4 |
a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the enzyme cleaves with an almost absolute specificity its RNA substrate in the middle of the GGAG tetranucleotide mainly found in the Shine-Dalgarno sequence |
Tequatrovirus T4 |
a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | a [pre-mRNA]-containing guanosine-adenosine + H2O |
the sequence-specific endoribonuelease RegB introduces cuts in early phage messenger RNAs. In most cases, cutting takes place in the middle of the tetranacleotide GGAG. Efficient cleavages occur in the motifs located in intergenic regions, some of them being Shine-Dalgamo sequences. When located in a coding sequence, this tetranucleotide is poorly recognized or not at all |
Tequatrovirus T4 |
a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate |
- |
? |
| 4.6.1.25 | GGUGCGAGAAAACGGAGCACC + H2O |
i.e. Selex22tb RNA. The enzyme produces a cyclic 2',3'-phosphodiester product |
Tequatrovirus T4 |
GGUGCGAGAAAACGG + AGCACC |
- |
? |
