Cloned (Comment) | Organism |
---|---|
the wild-type RegB protein and the four histidine-to-alanine mutants are expressed in Escherichia coli strain XL1-Blue using the phage lCE6 induction system | Tequatrovirus T4 |
Protein Variants | Comment | Organism |
---|---|---|
H42A | the mutant enzyme cleaves the substrate with a rate similar to that of the wild-type enzyme | Tequatrovirus T4 |
H48A | mutation completely abolishes activity without changing its ability to bind the substrate or affecting its overall structure | Tequatrovirus T4 |
H68A | mutation significantly reduces RegB activity without changing its ability to bind the substrate or affecting its overall structure | Tequatrovirus T4 |
H73A | the mutant enzyme cleaves the substrate with a rate similar to that of the wild-type enzyme | Tequatrovirus T4 |
R52L | inactive mutant enzyme | Tequatrovirus T4 |
Natural Substrates | Organism | Comment (Nat. Sub.) | Natural Products | Comment (Nat. Pro.) | Rev. | Reac. |
---|---|---|---|---|---|---|
a [pre-mRNA]-containing guanosine-adenosine + H2O | Tequatrovirus T4 | the enzyme controls the expression of a number of phage early genes. It cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site | a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate | - |
? |
Organism | UniProt | Comment | Textmining |
---|---|---|---|
Tequatrovirus T4 | P13312 | - |
- |
Purification (Comment) | Organism |
---|---|
- |
Tequatrovirus T4 |
Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
---|---|---|---|---|---|---|
a [pre-mRNA]-containing guanosine-adenosine + H2O | the enzyme controls the expression of a number of phage early genes. It cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site | Tequatrovirus T4 | a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate | - |
? | |
a [pre-mRNA]-containing guanosine-adenosine + H2O | the enzyme cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site. It produces a cyclic 2',3'-phosphodiester product | Tequatrovirus T4 | a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate | - |
? | |
GGUGCGAGAAAACGGAGCACC + H2O | i.e. Selex22tb RNA. The enzyme produces a cyclic 2',3'-phosphodiester product | Tequatrovirus T4 | GGUGCGAGAAAACGG + AGCACC | - |
? |
Synonyms | Comment | Organism |
---|---|---|
endoribonuclease RegB | - |
Tequatrovirus T4 |
Temperature Stability Minimum [°C] | Temperature Stability Maximum [°C] | Comment | Organism |
---|---|---|---|
25 | - |
stable for several days | Tequatrovirus T4 |
General Information | Comment | Organism |
---|---|---|
physiological function | the enzyme controls the expression of a number of phage early genes | Tequatrovirus T4 |