Any feedback?
Please rate this page
(search_result.php)
(0/150)

BRENDA support

Refine search

Search Substrates and Products (Substrate)

show results
Don't show organism specific information (fast!)
Search organism in taxonomic tree (slow, choose "exact" as search mode, e.g. "mammalia" for rat,human,monkey,...)
(Not possible to combine with the first option)
Refine your search

Search term:

Results 1 - 10 of 50 > >>
EC Number Substrates Commentary Substrates Organism Products Commentary (Products) Reversibility
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.322',3'-cAMP + H2O - Acetivibrio thermocellus ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-dTMP + H2O - Tequatrovirus T4 ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phopsho-5'-hydroxy-DNA the enzyme is capable of converting a 3'-phosphate/5'-OH strand of nicked DNA, which is unreparable by DNA ligase into a reparable 3'-OH/5'-phosphate nick in double stranded DNA Rattus norvegicus ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phopsho-5'-hydroxy-DNA role in repair of DNA strand breaks caused by oxidative damage Homo sapiens ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phospho-5'-hydroxy-ATTCGTGTGAGAAAACCCAACCCGCCCTACCCAAAAGTCAGATGA + H2O the enzyme mediates 5'-phosphorylation of ATTCGTGTGAGAAAACCCAACCCGCCCTACCCAAAAGTCAGATGA Tequatrovirus T4 ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phospho-5'-hydroxy-DNA - Saccharomyces cerevisiae ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phospho-5'-hydroxy-DNA - Tequatrovirus T4 ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phospho-5'-hydroxy-DNA + H2O - Homo sapiens ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phospho-5'-hydroxy-DNA + H2O - Tequatrovirus T4 ? - ?
Display the word mapDisplay the reaction diagram Show all sequences 3.1.3.323'-phospho-5'-hydroxy-poly(dT,dA) + H2O poly(dT,dA) with a 3' phosphate and and 5' OH group, preparation of substrate, presence of ATP Rattus norvegicus 3'-hydroxy-5'-phospho-poly(dT,dA) - ?
Results 1 - 10 of 50 > >>