Any feedback?
Please rate this page
(search_result.php)
(0/150)

BRENDA support

Refine search

Search Inhibitors

show results
Don't show organism specific information (fast!)
Search organism in taxonomic tree (slow, choose "exact" as search mode, e.g. "mammalia" for rat,human,monkey,...)
(Not possible to combine with the first option)
Refine your search
Image of 2D Structure
Search for synonyms (with exact matching search term)

Search term:

Results 1 - 10 of 34 > >>
download as CSV
download all results as CSV
EC Number Inhibitors Commentary Structure
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5abc protein anti recBCD; binds the recBCD enzyme and inhibits recombination but not exonuclease activity; gamma-protein analog encoded by bacteriophage P22 Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5ATP 0.2 mM and higher concentrations inhibits phosphodiester hydrolysis; neither the rate nor the extent of hydrolysis of single-stranded DNA nor ATP is affected Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5ATP 0.2 mM and higher concentrations inhibits phosphodiester hydrolysis Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5ATP - Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5bacteriophage Mu induction of bacteriophage Mu causes inhibition of exonuclease V Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5d(GATCATTACTAGGCAGGTGG) 3'20-merChio Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5d(GATCATTACTAGGCTGGTGG) 3'20-merChi+ Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5d(GATTAGGCaGGTGG) 3'14-merChio Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5d(GATTAGGCTGGTGG) 3'14-merChi+ Go to the Ligand Summary Page
Display the word mapDisplay the reaction diagram Show all sequences 3.1.11.5d(GCAGGTGG) 8-merChio Go to the Ligand Summary Page
Results 1 - 10 of 34 > >>
download as CSV
download all results as CSV