Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary extracted from

  • Saida, F.; Uzan, M.; Bontems, F.
    The phage T4 restriction endoribonuclease RegB a cyclizing enzyme that requires two histidines to be fully active (2003), Nucleic Acids Res., 31, 2751-2758 .
    View publication on PubMedView publication on EuropePMC

Cloned(Commentary)

EC Number Cloned (Comment) Organism
4.6.1.25 the wild-type RegB protein and the four histidine-to-alanine mutants are expressed in Escherichia coli strain XL1-Blue using the phage lCE6 induction system Tequatrovirus T4

Protein Variants

EC Number Protein Variants Comment Organism
4.6.1.25 H42A the mutant enzyme cleaves the substrate with a rate similar to that of the wild-type enzyme Tequatrovirus T4
4.6.1.25 H48A mutation completely abolishes activity without changing its ability to bind the substrate or affecting its overall structure Tequatrovirus T4
4.6.1.25 H68A mutation significantly reduces RegB activity without changing its ability to bind the substrate or affecting its overall structure Tequatrovirus T4
4.6.1.25 H73A the mutant enzyme cleaves the substrate with a rate similar to that of the wild-type enzyme Tequatrovirus T4
4.6.1.25 R52L inactive mutant enzyme Tequatrovirus T4

Natural Substrates/ Products (Substrates)

EC Number Natural Substrates Organism Comment (Nat. Sub.) Natural Products Comment (Nat. Pro.) Rev. Reac.
4.6.1.25 a [pre-mRNA]-containing guanosine-adenosine + H2O Tequatrovirus T4 the enzyme controls the expression of a number of phage early genes. It cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
-
 ?

Organism

EC Number Organism UniProt Comment Textmining
4.6.1.25 Tequatrovirus T4 P13312
-
-

Purification (Commentary)

EC Number Purification (Comment) Organism
4.6.1.25
-
 Tequatrovirus T4

Substrates and Products (Substrate)

EC Number Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
4.6.1.25 a [pre-mRNA]-containing guanosine-adenosine + H2O the enzyme controls the expression of a number of phage early genes. It cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site Tequatrovirus T4 a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
-
 ?
4.6.1.25 a [pre-mRNA]-containing guanosine-adenosine + H2O the enzyme cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site. It produces a cyclic 2',3'-phosphodiester product Tequatrovirus T4 a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
-
 ?
4.6.1.25 GGUGCGAGAAAACGGAGCACC + H2O i.e. Selex22tb RNA. The enzyme produces a cyclic 2',3'-phosphodiester product Tequatrovirus T4 GGUGCGAGAAAACGG + AGCACC
-
 ?

Synonyms

EC Number Synonyms Comment Organism
4.6.1.25 endoribonuclease RegB
-
 Tequatrovirus T4

Temperature Stability [°C]

EC Number Temperature Stability Minimum [°C] Temperature Stability Maximum [°C] Comment Organism
4.6.1.25 25
-
 stable for several days Tequatrovirus T4

General Information

EC Number General Information Comment Organism
4.6.1.25 physiological function the enzyme controls the expression of a number of phage early genes Tequatrovirus T4