Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 4.6.1.22 extracted from

  • Mathy, N.; Hebert, A.; Mervelet, P.; Benard, L.; Dorleans, A.; Li De La Sierra-Gallay, I.; Noirot, P.; Putzer, H.; Condon, C.
    Bacillus subtilis ribonucleases J1 and J2 form a complex with altered enzyme behaviour (2010), Mol. Microbiol., 75, 489-498.
    View publication on PubMed
Search for more literature for 4.6.1.22

Cloned(Commentary)

Cloned (Comment) Organism
cloning of rnjB gene, encoding RNase J2, and/or rnjA gene expressing RNase J1 in the pET28a vector together or alone. Overexpression of C-terminal His-tagged RNase J1 and/or C-terminal His-tagged RNase J2 simultaneously or alone in Escherichia coli strain BL21 CodonPlus Bacillus subtilis

KM Value [mM]

KM Value [mM] KM Value Maximum [mM] Substrate Comment Organism Structure
0.00022
-
 30 nt RNA RNase J1/J2 complex Bacillus subtilis
0.00047
-
 30 nt RNA RNase J1 Bacillus subtilis
0.00596
-
 30 nt RNA RNase J2 Bacillus subtilis

Molecular Weight [Da]

Molecular Weight [Da] Molecular Weight Maximum [Da] Comment Organism
300000
-
 RNase J1 in complex with RNase J2, gel filtration Bacillus subtilis

Organism

Organism UniProt Comment Textmining
Bacillus subtilis
-
 derivative of W168
-

Purification (Commentary)

Purification (Comment) Organism
RNases J1, J2 and the RNase J1/J2 complex purified on cobalt column and by gel filtration Bacillus subtilis

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
20 nt RNA + H2O 32pUGGUGGUGGAUCCCGGGAUC, exoribonuclease activity Bacillus subtilis ?
-
 ?
30 nt RNA
-
 Bacillus subtilis ?
-
 ?
30 nt RNA + H2O RT-FeDEx assay of RNase J1, J2 and the RNase J1/J2 complex, 30 nt RNA labelled with a carboxyfluorescein group at its 3'-end and hybridized to a 17 nt DNA bearing a 5'-quenching group carboxymethylrhodamine, exoribonuclease activity Bacillus subtilis ?
-
 ?
350 nt RNA + H2O 5'-triphosphate-labelled 350 nt fragment corresponding to the Bacillus subtilis thrS leader mRNA and 46 nts of coding sequence, and a 570 nt fragment corresponding to the hbs P3 transcript, endonucleolytic activity Bacillus subtilis ?
-
 ?

Subunits

Subunits Comment Organism
heterotetramer RNase J1 in complex with RNase J2, gel filtration Bacillus subtilis

Synonyms

Synonyms Comment Organism
ribonuclease J1
-
 Bacillus subtilis
ribonuclease J2
-
 Bacillus subtilis
RNase J1
-
 Bacillus subtilis
RNase J2
-
 Bacillus subtilis

Turnover Number [1/s]

Turnover Number Minimum [1/s] Turnover Number Maximum [1/s] Substrate Comment Organism Structure
0.005
-
 30 nt RNA RNase J2 Bacillus subtilis
0.13
-
 30 nt RNA RNase J1/J2 complex Bacillus subtilis
0.58
-
 30 nt RNA RNase J1 Bacillus subtilis

pI Value

Organism Comment pI Value Maximum pI Value
Bacillus subtilis RNase J1, calculated from sequence
-
 6.2
Bacillus subtilis RNase J2, calculated from sequence
-
 9

General Information

General Information Comment Organism
physiological function RNase J1 is essential, while its paralogue RNase J2 is not. RNases J1 and J2 form a complex that is likely to be the predominant form of these enzymes in wild-type cells: RNase J2 co-purifies with His-tagged RNase J1 from Escherichia coli or with Flag-tagged RNase J1 from Bacillus subtilis and RNases J1 and J2 interact in vivo in a yeast two-hybrid assay. While both RNase J1 and the RNase J1/J2 complex have robust 5'-to-3' exoribonuclease activity in vitro, RNase J2 has at least two orders of magnitude weaker exonuclease activity. Association of the two proteins also has an effect on the endoribonucleolytic properties of RNases J1 and J2. While the individual enzymes have similar endonucleolytic cleavage activities and specificities, as a complex they behave synergistically to alter cleavage site preference and to increase cleavage efficiency at specific sites Bacillus subtilis