Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
a [pre-mRNA fragment]- adenosine-2',3'-cyclophosphate + H2O = a [pre-mRNAfragment]-3'-adenosine-3'-phosphate
(1b)
-
-
-
a [pre-mRNA]-containing guanosine-adenosine + H2O = a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
overall reaction
-
-
-
a [pre-mRNA]-containing guanosine-adenosine + H2O = a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-adenosine-2',3'-cyclophosphate
(1a)
-
-
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
[pre-mRNA]-guanosine-adenosine 5'-hydroxy-guanosine-ribonucleotide-3'-[RNA fragment]-lyase (cyclicizing; [RNA fragment]-3'- adenosine -2',3'-cyclophosphate-forming and hydrolysing)
The enzyme from bacteriophage T4 cleaves early mRNAs between Ap and Gp at one specific specific GpGpApGp site, favouring their further transition to middle-phase mRNA. The activity is enhanced by Ribosomal S1 protein. The enzyme catalyses a two-stage endonucleolytic cleavage. The first reaction produces 5'-hydroxy-phosphooligonucletides and 3'-phosphooligonucleotides ending with 2',3'-cyclic phosphodiester, which are released from the enzyme. The enzyme then hydrolyses these cyclic compounds in a second reaction that takes place only when all the susceptible 3',5'-phosphodiester bonds have been cyclised. The second reaction is a reversal of the first reaction using the hydroxyl group of water instead of the 5'-hydroxyl group of ribose. The overall process is that of a phosphorus-oxygen lyase followed by hydrolysis to form the 3'-nucleotides.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
GGUGCGAGAAAACGGAGCACC + H2O
GGUGCGAGAAAACGG + AGCACC
Substrates: i.e. Selex22tb RNA. The enzyme produces a cyclic 2',3'-phosphodiester product
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O

a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: -
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme cleaves with an almost absolute specificity its RNA substrate in the middle of the GGAG tetranucleotide mainly found in the Shine-Dalgarno sequence
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the sequence-specific endoribonuelease RegB introduces cuts in early phage messenger RNAs. In most cases, cutting takes place in the middle of the tetranacleotide GGAG. Efficient cleavages occur in the motifs located in intergenic regions, some of them being Shine-Dalgamo sequences. When located in a coding sequence, this tetranucleotide is poorly recognized or not at all
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O

a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme is necessary for the degradation of early but not middle or late mRNAs. The synthesis of several early proteins is down-regulated, probably as a consequence of RegB cleavages in the Shine-Dalgarno sequence of these genes. The synthesis of several other proteins is up-regulated, suggesting that processing by RegB might improve translation by changing the conformation of a transcript
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme controls the expression of a number of phage early genes. It cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme participates in the bacteriophage T4 life cycle by favoring early messenger RNA breakdown. It specifically cleaves GGAG sequences found in intergenic regions, mainly in translation initiation sites
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme cleaves early mRNAs between Ap and Gp at one specific specific GpGpApGp site. Many intergenic GGAG motifs, including Shine-Dalgarno sequences, are not substrates for RegB
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site. It produces a cyclic 2',3'-phosphodiester product
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme specifically cleaves GGAG sequences found in intergenic regions, mainly in translation initiation sites
Products: -
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5' hydroxy-guanosine-[pre-mRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: -
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
a [pre-mRNA]-containing guanosine-adenosine + H2O

a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme is necessary for the degradation of early but not middle or late mRNAs. The synthesis of several early proteins is down-regulated, probably as a consequence of RegB cleavages in the Shine-Dalgarno sequence of these genes. The synthesis of several other proteins is up-regulated, suggesting that processing by RegB might improve translation by changing the conformation of a transcript
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme controls the expression of a number of phage early genes. It cleaves early mRNAs between Ap and Gp at one specific GpGpApGp site
Products: -
?
a [pre-mRNA]-containing guanosine-adenosine + H2O
a 5'-hydroxy-guanosine-[premRNA fragment] + a [pre-mRNA fragment]-3'-adenosine-3'-phosphate
Substrates: the enzyme participates in the bacteriophage T4 life cycle by favoring early messenger RNA breakdown. It specifically cleaves GGAG sequences found in intergenic regions, mainly in translation initiation sites
Products: -
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Escherichia coli host ribosomal protein S1
S1 acts as a cofactor of the T4 phage RegB endoribonuclease. S1 binds RNA substrates and promotes cleavage by RegB. Direct interaction between phage T4 protein RIII and Escherichia coli host ribosomal protein S1 inhibits endoribonuclease RegB activation. The 70 kDa RIII protein mainly targets the 5th domain of S1. RIII interacts with S1 at a molar ratio of 1:1
-
ribosomal 30 S subunit
the activity of the enzyme (RegB) is very low but can be enhanced up to 100fold by the ribosomal 30 S subunit or by ribosomal protein S1
-
ribosomal protein S1
the activity of the enzyme (RegB) is very low but can be enhanced up to 100fold by the ribosomal 30 S subunit or by ribosomal protein S1
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
additional information
the recombinant protein RIII of T4 copurifies with the host ribosomal protein S1 in stoichiometric amounts
physiological function

the enzyme is necessary for the degradation of early but not middle or late mRNAs. The synthesis of several early proteins is down-regulated, probably as a consequence of RegB cleavages in the Shine-Dalgarno sequence of these genes. TRegB also regulates the translation of several prereplicative genes
physiological function
the enzyme controls the expression of a number of phage early genes
physiological function
the enzyme participates in the bacteriophage T4 life cycle by favoring early messenger RNA breakdown
physiological function
inactivates a sub-class of early mRNA by cleaving Shine-Dalgamo sequences, and (ii) it is necessary for the degradation of early mRNAs, but not of middle and late mRNAs
physiological function
protein RIII is known as a cytoplasmic antiholin, which plays a role in the lysis inhibition function of T4. Protein RIII also acts as a viral effector protein mainly targeting Escherichia coli host S1 RNA-binding domains that are central for all the activities of this multifunctional protein. ribosomal protein S1 is the largest (61 kDa) flexible protein of the ribosome complex. The S1-RIII interaction prevents the S1-dependent activation of endoribonuclease RegB. During T4 phage infection, S1 acts as a cofactor of the T4 phage RegB endoribonuclease. S1 binds RNA substrates and promotes cleavage by RegB of the partially structured AG-rich RNAs and unstructured RNA having an 11-nucleotide-conserved sequence. The minimal domain combination required for stimulation of RegB nuclease is D4-D5, whereas the peptide containing all C-terminal domains (D3-D4-D5-D6) stimulates RegB to the same extent as the full-length protein. The activity of RNase RegB is limited to the early period of T4 infection, it is deactivated by protein RIII
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
D51G
mutant form loses toxicity when expressed in Escherichia coli from standard expression vectors
E105A
mutant form loses toxicity when expressed in Escherichia coli from standard expression vectors
E19A
mutation lowers toxicity without completely abolishing it when expressed in Escherichia coli from standard expression vectors
E19V
mutation lowers toxicity without completely abolishing it when expressed in Escherichia coli from standard expression vectors
E21V
mutation has no influence on toxicity when expressed in Escherichia coli from standard expression vectors
H42A
the mutant enzyme cleaves the substrate with a rate similar to that of the wild-type enzyme
H68A
mutation significantly reduces RegB activity without changing its ability to bind the substrate or affecting its overall structure
H73A
the mutant enzyme cleaves the substrate with a rate similar to that of the wild-type enzyme
R11Q
mutant form loses toxicity when expressed in Escherichia coli from standard expression vectors
R52L
inactive mutant enzyme
R56L
mutant form loses toxicity when expressed in Escherichia coli from standard expression vectors
additional information
construction of a T4 DELTAregB single mutant and a T4 DELTArIIIDELTAregB double mutant
H48A

mutation completely abolishes activity without changing its ability to bind the substrate or affecting its overall structure
H48A
mutant enzyme binds its RNA substrate with the same affinity as the wild type protein. The beta-sheet content of the RegB H48A secondary structure is probably poor but not nil
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
by coupling the toxic restriction endoribonuclease RegB, from the bacteriophage T4, to the prokaryotic T7 and the eukaryotic GAL1 promoters, a two-function plasmid called pTOXR-1 is constructed. This plasmid is a zero-background cloning vector. It allows an efficient positive selection of recombinant plasmids without the need to completely digest, dephosphorylate, or purify the vector prior to the ligation step. The pTOXR-1 positive selection system requires no special Escherichia coli strains, no special culture media, and no addition of inducer to the selective plates. In addition, since this vector carries all signals required for both prokaryotic and eukaryotic expression, it allows the overproduction of heterologous proteins, fused to a polyhistidine tag, in the bacterium Escherichia coli and in the yeast Saccharomyces cerevisiae from a single plasmid. Hence, this vector may be a useful time-saving tool for onestep cloning and versatile protein expression in bacteria and yeast
expression in Escherichia coli strain BL21(DE3)-pLysS, transformed with plasmid pEH48A. RegB is highly toxic to Escherichia coli, preventing its overproduction from standard expression vectors
expression in Saccharomyces cerevisiae
recombinant expression of wild-type an dmutant enzymes in Escherichia coli strain BL21 (DE3), subcloning in Escherichia coli strain DH10B
the wild-type RegB protein and the four histidine-to-alanine mutants are expressed in Escherichia coli strain XL1-Blue using the phage lCE6 induction system
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Odaert, B.; Saida, F.; Aliprandi, P.; Durand, S.; Crechet, J.B.; Guerois, R.; Laalami, S.; Uzan, M.; Bontems, F.
Structural and functional studies of RegB, a new member of a family of sequence-specific ribonucleases involved in mRNA inactivation on the ribosome
J. Biol. Chem.
282
2019-2028
2007
Tequatrovirus T4 (P13312)
brenda
Sanson, B.; Hu, R.M.; Troitskayadagger, E.; Mathy, N.; Uzan, M.
Endoribonuclease RegB from bacteriophage T4 is necessary for the degradation of early but not middle or late mRNAs
J. Mol. Biol.
297
1063-1074
2000
Tequatrovirus T4 (P13312)
brenda
Saida, F.; Uzan, M.; Bontems, F.
The phage T4 restriction endoribonuclease RegB a cyclizing enzyme that requires two histidines to be fully active
Nucleic Acids Res.
31
2751-2758
2003
Tequatrovirus T4 (P13312)
brenda
Sada, F.; Uzan, M.; Lallemand, J.; Bontems, F.
New system for positive selection of recombinant plasmids and dual expression in yeast and bacteria based on the restriction ribonuclease RegB
Biotechnol. Prog.
19
727-733
2003
Tequatrovirus T4 (P13312)
brenda
Sanson, B.; Uzan, M.
Post-transcriptional controls in bacteriophage T4 roles of the sequence-specific endoribonuclease RegB
FEMS Microbiol. Rev.
17
141-150
1995
Tequatrovirus T4 (P13312)
brenda
Saida, F.; Odaert, B.; Uzan, M.; Bontems, F.
First structural investigation of the restriction ribonuclease RegB NMR spectroscopic conditions, 13C/15N double-isotopic labelling and two-dimensional heteronuclear spectra
Protein Expr. Purif.
34
158-165
2004
Tequatrovirus T4 (P13312)
brenda
Juskauskas, A.; Zajanckauskaite, A.; Meskys, R.; Ger, M.; Kaupinis, A.; Valius, M.; Truncaite, L.
Interaction between phage T4 protein RIII and host ribosomal protein S1 inhibits endoribonuclease RegB activation
Int. J. Mol. Sci.
23
9483
2022
Tequatrovirus T4 (P13312)
brenda