Information on EC 3.1.3.32 - polynucleotide 3'-phosphatase

for references in articles please use BRENDA:EC3.1.3.32
Word Map on EC 3.1.3.32
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Select one or more organisms in this record:

The enzyme appears in viruses and cellular organisms

EC NUMBER
COMMENTARY hide
3.1.3.32
-
RECOMMENDED NAME
GeneOntology No.
polynucleotide 3'-phosphatase
REACTION
REACTION DIAGRAM
COMMENTARY hide
ORGANISM
UNIPROT
LITERATURE
a 3'-phosphopolynucleotide + H2O = a polynucleotide + phosphate
show the reaction diagram
REACTION TYPE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
hydrolysis
hydrolysis of phosphoric ester
-
-
-
-
Phosphorylation
-
-
-
-
SYSTEMATIC NAME
IUBMB Comments
polynucleotide 3'-phosphohydrolase
Also hydrolyses nucleoside 2'-, 3'- and 5'-monophosphates, but only 2'- and 3'-phosphopolynucleotides.
CAS REGISTRY NUMBER
COMMENTARY hide
37288-16-7
-
ORGANISM
COMMENTARY hide
LITERATURE
UNIPROT
SEQUENCE DB
SOURCE
-
SwissProt
Manually annotated by BRENDA team
-
-
-
Manually annotated by BRENDA team
polynucleotide 5'-kinase and 3'-phosphatase
UniProt
Manually annotated by BRENDA team
-
-
-
Manually annotated by BRENDA team
bifunctional enzyme with proximal 5-kinase and disal 3-phosphatase activity
-
-
Manually annotated by BRENDA team
bifunctional enzyme with proximal 5-kinase and disal 3-phosphatase activity
-
-
Manually annotated by BRENDA team
-
SwissProt
Manually annotated by BRENDA team
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
evolution
-
differences between PfPNKP and the other PNKP Walker A box/P loops: the sequence of the P-loop consensus sequence is hGxPGxGKSTh (h is hydrophobic, x is any amino acid), whereas the sequence of the P-loop of PfPNKP is IGPPGCGKTFL. Second, the difference between glutamic acid at position 330 of PfPNKP
malfunction
metabolism
physiological function
additional information
SUBSTRATE
PRODUCT                       
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
2',3'-cAMP + H2O
?
show the reaction diagram
-
-
-
-
?
3'-dTMP + H2O
?
show the reaction diagram
-
-
-
-
?
3'-phopsho-5'-hydroxy-DNA
?
show the reaction diagram
3'-phospho-5'-hydroxy-ATTCGTGTGAGAAAACCCAACCCGCCCTACCCAAAAGTCAGATGA + H2O
?
show the reaction diagram
-
the enzyme mediates 5'-phosphorylation of ATTCGTGTGAGAAAACCCAACCCGCCCTACCCAAAAGTCAGATGA
-
-
?
3'-phospho-5'-hydroxy-DNA
?
show the reaction diagram
3'-phospho-5'-hydroxy-DNA + H2O
?
show the reaction diagram
3'-phospho-5'-hydroxy-poly(dT,dA) + H2O
3'-hydroxy-5'-phospho-poly(dT,dA)
show the reaction diagram
-
poly(dT,dA) with a 3' phosphate and and 5' OH group, preparation of substrate, presence of ATP
-
?
3'-phospho-5'-hydroxy-RNA + H2O
?
show the reaction diagram
-
-
-
-
?
3'-phosphopolynucleotide + H2O
polynucleotide + phosphate
show the reaction diagram
3'-TMP + H2O
?
show the reaction diagram
-
-
-
-
?
a RNA 2',3'-cyclic phosphate end + H2O
a RNA 3'-phosphate + phosphate
show the reaction diagram
-
the enzyme also has RNA 2'-phosphatase activity
-
-
?
bis-p-nitrophenyl phosphate + H2O
?
show the reaction diagram
-
-
-
-
?
bis-p-nitrophenyl phosphate + H2O
p-nitrophenyl phosphate + phosphate
show the reaction diagram
-
-
-
-
?
bleomycin-damaged DNA + H2O
?
show the reaction diagram
-
-
?
cAMP + H2O
?
show the reaction diagram
-
-
-
-
?
d(TTTAATCAATTGCGACCCp) + H2O
phosphate + d(TTTAATCAATTGCGACCC)
show the reaction diagram
-
reaction with the end-healing domain Rnl1-(394-694), that consists of a proximal 5'-kinase module with an essential P-loop motif (404GSGKS408) and a distal 3'-phosphatase module with an essential acylphosphatase motif (560DLDGT564)
-
-
?
DNA with 3'-phosphate ends + H2O
DNA + phosphate
show the reaction diagram
-
-
-
?
DNA with 5'-hydroxyl ends + ATP
DNA with 5'-phosphate ends + ADP
show the reaction diagram
-
-
-
?
DNA with single-strand breaks + H2O
?
show the reaction diagram
-
-
?
dsDNA + H2O
?
show the reaction diagram
dTMp + H2O
dT + phosphate
show the reaction diagram
FAM-5'-TAGAGAGAGAGAGAGAGAGAGAGCGCA CCTAAAGGGTGCG-phospho-3' + H2O
FAM-5'-TAGAGAGAGAGAGAGAGAGAGAGCGCA CCTAAAGGGTGCG-hydroxyl-3' + phosphate
show the reaction diagram
-
the primer probe can be dephosphorylated by the enzyme into a 3'-hydroxyl end
-
-
?
H2O2-damaged DNA + H2O
?
show the reaction diagram
-
-
?
oligodeoxyadenylate 3'-phosphate + H2O
oligodeoxyadenylate + phosphate
show the reaction diagram
-
-
-
?
p-nitrophenyl phenylphosphonate + H2O
?
show the reaction diagram
-
-
-
-
?
p-nitrophenyl phosphate + H2O
p-nitrophenol + phosphate
show the reaction diagram
-
-
-
-
?
phosphorylated DNA-ends + H2O
DNA-ends + phosphate
show the reaction diagram
pTp + H2O
pT + phosphate
show the reaction diagram
thymidine 3'-monophosphate + H2O
thymidine + phosphate
show the reaction diagram
-
-
-
?
additional information
?
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
3'-phopsho-5'-hydroxy-DNA
?
show the reaction diagram
3'-phospho-5'-hydroxy-DNA + H2O
?
show the reaction diagram
3'-phospho-5'-hydroxy-RNA + H2O
?
show the reaction diagram
-
-
-
-
?
3'-phosphopolynucleotide + H2O
polynucleotide + phosphate
show the reaction diagram
a RNA 2',3'-cyclic phosphate end + H2O
a RNA 3'-phosphate + phosphate
show the reaction diagram
-
the enzyme also has RNA 2'-phosphatase activity
-
-
?
additional information
?
-
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
MgCl2
required, best at 10 mM
MnCl2
can replace MnCl2, at 1 mM
Zn2+
-
stimulates less efficiently than Mg2+, Mn2+
additional information
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
2-(1-hydroxyundecyl)-1-(4-nitrophenylamino)-6-phenyl-6,7a-dihydro-1H-pyrrolo[3,4-b]pyridine-5,7(2H,4aH)-dione
2-(hydroxy(3,4,5-trimethoxyphenyl)methyl)-1-(4-nitrophenylamino)-6-phenyl-6,7a-dihydro-1H-pyrrolo[3,4-b]pyridine-5,7(2H,4aH)-dione
-
A6B4C3
2-(hydroxy(phenyl)methyl)-1-(4-nitrophenylamino)-6-phenyl-6,7a-dihydro-1H-pyrrolo[3,4-b]pyridine-5,7(2H,4aH)-dione
-
A1B4C3
2-(hydroxy(thiophen-2-yl)methyl)-6-methyl-1-(phenylamino)-6,7a-dihydro-1H-pyrrolo[3,4-b]pyridine-5,7(2H,4aH)-dione
-
A39B1C2
diphosphate
-
no effect on 3'-phosphatase, inhibition of 5'-hydroxyl kinase
heparin
PO43-
-
5'-hydroxyl kinase, little effect on 3'-phosphatase
SO42-
-
5'-hydroxyl kinase, little effect on 3'-phosphatase
tert-butyl 2-(1-hydroxy-2,2-diphenylethyl)-6-methyl-5,7-dioxo-2,4a,5,6,7,7a-hexahydro-1H-pyrrolo[3,4-b]pyridin-1-ylcarbamate
-
A26B11C2
additional information
-
ACTIVATING COMPOUND
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
XRCC1
-
XRCC4
-
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
3.9 - 100
2',3'-cAMP
0.0000179
3'-phospho-5'-hydroxy-DNA
-
at pH 7.5 and 37C
0.548
3'-phosphopolynucleotide
-
-
0.006
3'-TMP
-
-
0.069
ATP
-
-
1.6 - 88
bis-p-nitrophenyl phosphate
0.0039
DNA with 5'-hydroxyl ends
-
-
67
p-Nitrophenyl phenylphosphonate
-
wild type enzyme, in 50 mM Tris-HCl (pH 7.5), 0.5 mM MnCl2, at 45C
1 - 75
p-nitrophenyl phosphate
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
0.04 - 34.33
2',3'-cAMP
0.42
3'-phospho-5'-hydroxy-DNA
-
at pH 7.5 and 37C
0.26 - 253.3
bis-p-nitrophenyl phosphate
0.58 - 6.08
dTMP
27.83
p-Nitrophenyl phenylphosphonate
-
wild type enzyme, in 50 mM Tris-HCl (pH 7.5), 0.5 mM MnCl2, at 45C
1.88 - 146.7
p-nitrophenyl phosphate
0.003 - 0.0043
phosphorylated DNA ends
-
additional information
2',3'-cAMP
-
mutant enzyme D236E, in 50 mM Tris-HCl (pH 7.5), 0.5 mM MnCl2, at 45C
kcat/KM VALUE [1/mMs-1]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
23330
3'-phospho-5'-hydroxy-DNA
-
at pH 7.5 and 37C
IC50 VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
0.00006
2-(1-hydroxyundecyl)-1-(4-nitrophenylamino)-6-phenyl-6,7a-dihydro-1H-pyrrolo[3,4-b]pyridine-5,7(2H,4aH)-dione
Homo sapiens
-
near maximal inhibition with 0.010 mM
0.0003
2-(hydroxy(3,4,5-trimethoxyphenyl)methyl)-1-(4-nitrophenylamino)-6-phenyl-6,7a-dihydro-1H-pyrrolo[3,4-b]pyridine-5,7(2H,4aH)-dione
Homo sapiens
-
-
additional information
2-(1-hydroxyundecyl)-1-(4-nitrophenylamino)-6-phenyl-6,7a-dihydro-1H-pyrrolo[3,4-b]pyridine-5,7(2H,4aH)-dione
SPECIFIC ACTIVITY [µmol/min/mg]
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
1.8
-
substrate thymidine 3'-monophosphate
19
-
3-phosphatase activity
additional information
genotype variant NKP T5644G in polynucleotide kinase 3' phosphatase (PNKP) and risk of adenoma recurrence analyzed by unconditional logistic regression models, SNP genotyping, allele-specific PCR and mass spectromety, no association or effect modification between genotype, dietary components and risk of adenoma recurrence, PNKP T5644G variant not involved in adenoma recurrence
pH OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
7
-
in the presence of Mn2+
7.2
-
assay at
7.4
-
assay at
7.5
-
3'-phosphatase activity, 2 optima: pH 6.0 and pH 7.5
8.2
-
assay at
pH RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
5 - 7.5
-
pH 5.0: about 30% of maximal activity, pH 7.5: about 35% of maximal activity, reaction with the end-healing domain Rnl1-(394-694)
5.5 - 7
-
pH 5.5: about 50% of maximal activity, pH 7.0: abput 35% of maximal activity
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
TEMPERATURE RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
60 - 80
-
60C: about 50% of maximal activity, 80C: about 80% of maximal activity
SOURCE TISSUE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
SOURCE
-
-
Manually annotated by BRENDA team
LOCALIZATION
ORGANISM
UNIPROT
COMMENTARY hide
GeneOntology No.
LITERATURE
SOURCE
-
the enzyme contains a functional mitochondrial-targeting signal, consisting of amino acids 432-441 (ARYVQCARAA), close to its C-terminus
Manually annotated by BRENDA team
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
45000
x * 45000, SDS-PAGE
55584
-
x * 55584, recombinant GST-tagged enzyme, mass spectrometry
60000
-
gel filtration
73000
x * 73000, SDS-PAGE of recombinant His6-tagged enzyme
79000
-
gel filtration
80000 - 160000
-
sedimentation analysis
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
dimer
-
2 * 40000, SDS-PAGE
homotetramer
-
x-ray crystallography
monomer
-
1 * 60000, SDS-PAGE
tetramer
-
4 * 40000, His10-tagged enzyme, SDS-PAGE
additional information
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
hanging drop vapour diffusion method with 100 mM sodium cacodylate (pH 6.6), 12% PEG-8000, 0.2 M ammonium sulfate, 20 mM urea, and 5 mM dithiothreitol, at 23C
-
N-terminal region (residues 1-139)
-
pH STABILITY
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
5.5 - 8
-
activity declines sharply at less than pH 5.5 or above pH 8.0
682186
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
37
-
5'-hydroxyl kinase activity inactivated much faster than 3'-phosphatase activity, ATP protects against thermal denaturation
60 - 65
-
2 h, stable up to
GENERAL STABILITY
ORGANISM
UNIPROT
LITERATURE
ATP protects against thermal denaturation and trypsin digestion
-
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
enzyme also is polynucleotide 5'-hydroxyl kinase
-
N-terminal region (residues 1-139), immobilized metal ion affinity chromatography, gel filtration
-
Ni-agarose chromatography
-
Ni-agarose column chromatography
-
Ni2+-nitrilotriacetic acid-agarose chromatography
-
nickel-agarose chromatography
-
recombinant GST-tagged enzyme from Escherichia coli strain Rosetta (DE3) pLysS by glutathione affinity chromatography
-
recombinant N-terminally His-tagged wild-type and mutant enzymes from Escherichia coli by nickel affinity chromatography
-
wild-type C-terminal domain Rnl1-(394-694) and mutated versions K407A and D560A, produced in Escherichia coli as a His10 fusion
-
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
DNA and amino acid sequence determination and analysis, expression of GST-tagged enzyme in Escherichia coli strain Rosetta (DE3) pLysS
-
expressed in Escherichia coli
-
expressed in Escherichia coli as His-tagged fusion protein
-
expressed in Escherichia coli BL21 (DE3) cells
-
expressed in Escherichia coli BL21(DE3) cells
-
expression in Escherichia coli
expression of N-or C-terminally His-tagged enzyme in A-549 cells, expression of N-terminally His-tagged wild-type and mutant enzymes in Escherichia coli
-
expression of wild-type and mutant enzymes in Escherichia coli strain DE3(BL21) pLysS
-
gene PfPNKP, DNA and amino acid sequence determination and analysis, expression of GST-PfPNKP in Escherichia coli strain Rosetta (DE3) pLysS
-
N-terminal region (residues 1-139) expressed in Escherichia coli Rosetta2(DE3) pLysS
-
wild-type C-terminal domain Rnl1-(394-694) and mutated versions K407A and D560A are produced in Escherichia coli as a His10 fusion. The end-healing domain Rnl1-(394-694) consists of a proximal 5'-kinase module with an essential P-loop motif (404GSGKS408) and a distal 3'-phosphatase module with an essential acylphosphatase motif (560DLDGT564)
-
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
D165A
-
inactivation of 3-phosphatase activity
D165E
-
inactivation of 3-phosphatase activity
D165N
-
inactivation of 3-phosphatase activity
D167A
-
inactivation of 3-phosphatase activity
D167E
-
inactivation of 3-phosphatase activity
D176A
-
inactivation of 3-phosphatase activity
D176K
-
inactivation of 3-phosphatase activity
D187A
-
less than 1% activity of the wild type enzyme
D187E
-
less than 1% activity of the wild type enzyme
D187N
-
less than 1% activity of the wild type enzyme
D213A
-
inactivation of 3-phosphatase activity
D213K
-
inactivation of 3-phosphatase activity
D254A
-
inactivation of 3-phosphatase activity
D254E
-
inactivation of 3-phosphatase activity
D254N
-
inactivation of 3-phosphatase activity
D277A
-
less than 1% activity of the wild type enzyme
D277E
-
retains 93% activity of the wild type enzyme
D277N
-
less than 1% activity of the wild type enzyme
D278A
-
inactivation of 3-phosphatase activity
D278E
-
partial inactivation of 3-phosphatase activity
E195A/Y205A
-
retains 22% activity of the wild type enzyme
E219A
-
retains 51% activity of the wild type enzyme
E233A
-
retains 45% activity of the wild type enzyme
E292A/W294A
-
retains 3% activity of the wild type enzyme
G212A
-
retains 37% activity of the wild type enzyme
K198A
-
retains 82% activity of the wild type enzyme
K253A
-
retains 95% activity of the wild type enzyme
K258A
-
less than 1% activity of the wild type enzyme
K258Q
-
less than 1% activity of the wild type enzyme
K258R
-
less than 1% activity of the wild type enzyme
M199A/Y200A
-
retains 19% activity of the wild type enzyme
N190A/M192A
-
retains 18% activity of the wild type enzyme
R126A
-
inactivation of 5-kinase activity
R126K
-
inactivation of 5-kinase activity
R126Q
-
inactivation of 5-kinase activity
R229A
-
retains 94% activity of the wild type enzyme
R246A
-
partial inactivation of 3-phosphatase activity
R246K
-
no inactivation
R279A
-
partial inactivation of 3-phosphatase activity
R287A/Q295A
-
retains 2% activity of the wild type enzyme
R38A
-
inactivation of 5-kinase activity
R38K
-
inactivation of 5-kinase activity
R38Q
-
inactivation of 5-kinase activity
S211T
-
shows 130% activity of the wild type enzyme
S298A/D300A
-
retains 27% activity of the wild type enzyme
T222A
-
retains 94% activity of the wild type enzyme
T251A
-
shows 120% activity of the wild type enzyme
D169A
-
half of wild type 5-kinase activity, almost complete loss of 3-phosphatase activity
K15A
-
no 5-kinase activity, reduced 3-phosphates activity
D175A
-
reduced 5-kinase activity, no 3-phosphatase activity
K16A
-
retains 5-kinase activity, reduced 3-phosphatase activity
D233E
-
decreased activity compared to the wild type enzyme for hydrolysis of 2',3'-cAMP
D392A
-
7-10% as active as wild type Pnkp
H189Q
-
decreased activity compared to the wild type enzyme
H264N
-
increased activity compared to the wild type enzyme
H264Q
-
decreased activity compared to the wild type enzyme
H323A
-
60% of wild type activity
H323Q
-
decreased activity compared to the wild type enzyme for hydrolysis of 2',3'-cAMP
H376A
-
7-10% as active as wild type Pnkp
N263A
-
7-10% as active as wild type Pnkp
D206A
-
some remaining activity
D206E
-
severely impaired activity
D218A
-
some remaining activity
D218E
-
no enzymic activity
D35A
-
no enzymic activity
D35E
-
some remaining activity
D35N
-
no enzymic activity
D37A
-
some remaining activity
D37E
-
severely impaired activity
K170A
-
no enzymic activity
S88A
-
severely impaired activity
T39A
-
some remaining activity
D560A
-
mutation abolishes phosphatase activity of the C-terminal domain Rnl1-(394-694)
K407A
-
mutation has no effect on phosphatase activity of the C-terminal domain Rnl1-(394-694)
additional information
Renatured/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
APPLICATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
pharmacology
-
PNKP, similar to several other DNA repair proteins, is of increasing clinical interest owing to the identification of small molecule inhibitors of these enzymes that sensitize cells to IR or chemotherapeutic agents