Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 6.5.1.1 extracted from

  • Lan, H.-Y.; Liu, C.; Hendry, P.
    Biochemical and enzymatic characterization of a thermostable DNA ligase encoded by thermophilic acidophilic archaebacterium strain JP2 (2006), Prog. Biochem. Biophys., 33, 881-889.
No PubMed abstract available
Search for more literature for 6.5.1.1

Cloned(Commentary)

Cloned (Comment) Organism
-
 uncultured archaeon

Metals/Ions

Metals/Ions Comment Organism Structure
Mn2+ the enzyme is most active when Mn2+ is present as divalent metal cofactor rather than Mg2+ and Ca2+ etc. uncultured archaeon

Organism

Organism UniProt Comment Textmining
uncultured archaeon
-
 acidophilic archaebacterium JP2 from geothermally active sites in Papua New Guinea
-

Purification (Commentary)

Purification (Comment) Organism
-
 uncultured archaeon

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m the donor strans is 42 bp (5'TCCGCGGATCCTGAGGTGAAATGTAAATGAAAAAGCCTGAAC3'), acceptor strand is 38 bp (5'CGTCGAGCAGCGAACCTACTGCGTGGCTTCCGGAGCTA3'), and the complement array stran is 80 bp (5'GTTCAGGCTTTTTCATTTACATTTCACCTCAGGATCCGCGGATAGCTCCGGAAGCCACGCAGTAGGTTCGCTGCTCGACG3') uncultured archaeon AMP + diphosphate + (deoxyribonucleotide)n+m
-
 ?

Synonyms

Synonyms Comment Organism
ATP-dependent DNA ligase
-
 uncultured archaeon

Temperature Optimum [°C]

Temperature Optimum [°C] Temperature Optimum Maximum [°C] Comment Organism
50 80 the enzyme displayed relative high activity uncultured archaeon
65
-
 assay at uncultured archaeon

Temperature Stability [°C]

Temperature Stability Minimum [°C] Temperature Stability Maximum [°C] Comment Organism
80
-
 5 h, about 5% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene uncultured archaeon
85
-
 5 h, about 10% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene uncultured archaeon
90
-
 1 h, about 55% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene uncultured archaeon
95
-
 10 min, about 80% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene uncultured archaeon

pH Optimum

pH Optimum Minimum pH Optimum Maximum Comment Organism
7.4
-
 assay at uncultured archaeon