Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 3.4.21.5 extracted from

  • Dobrovolsky, A.B.; Titaeva, E.V.; Khaspekova, S.G.; Spiridonova, V.A.; Kopylov, A.M.; Mazurov, A.V.
    Inhibition of thrombin activity with DNA-aptamers (2009), Bull. Exp. Biol. Med., 148, 33-36.
    View publication on PubMed

Inhibitors

Inhibitors Comment Organism Structure
additional information the DNA aptamers 15TBA (GGTTGGTGTGGTTGG) and 31TBA (CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG) added to human plasma dose-dependently increase fibrin formation upon exposure to exogenous thrombin, clotting activation by the extrinsic pathway, and activated partial clotting activation by the intrinsic pathway. At the same time, these aptamers do not modify amidolytic activity of thrombin Homo sapiens

Natural Substrates/ Products (Substrates)

Natural Substrates Organism Comment (Nat. Sub.) Natural Products Comment (Nat. Pro.) Rev. Reac.
fibrinogen + H2O Homo sapiens
-
fibrin + fibrinopeptide A + fibrinopeptide B
-
?

Organism

Organism UniProt Comment Textmining
Homo sapiens
-
-
-

Source Tissue

Source Tissue Comment Organism Textmining
blood plasma
-
Homo sapiens
-

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
fibrinogen + H2O
-
Homo sapiens fibrin + fibrinopeptide A + fibrinopeptide B
-
?
tosyl-Gly-L-Pro-L-Arg-4-nitroanilide + H2O
-
Homo sapiens tosyl-Gly-L-Pro-L-Arg + 4-nitroaniline
-
?