Inhibitors | Comment | Organism | Structure |
---|---|---|---|
additional information | the DNA aptamers 15TBA (GGTTGGTGTGGTTGG) and 31TBA (CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG) added to human plasma dose-dependently increase fibrin formation upon exposure to exogenous thrombin, clotting activation by the extrinsic pathway, and activated partial clotting activation by the intrinsic pathway. At the same time, these aptamers do not modify amidolytic activity of thrombin | Homo sapiens |
Natural Substrates | Organism | Comment (Nat. Sub.) | Natural Products | Comment (Nat. Pro.) | Rev. | Reac. |
---|---|---|---|---|---|---|
fibrinogen + H2O | Homo sapiens | - |
fibrin + fibrinopeptide A + fibrinopeptide B | - |
? |
Organism | UniProt | Comment | Textmining |
---|---|---|---|
Homo sapiens | - |
- |
- |
Source Tissue | Comment | Organism | Textmining |
---|---|---|---|
blood plasma | - |
Homo sapiens | - |
Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
---|---|---|---|---|---|---|
fibrinogen + H2O | - |
Homo sapiens | fibrin + fibrinopeptide A + fibrinopeptide B | - |
? | |
tosyl-Gly-L-Pro-L-Arg-4-nitroanilide + H2O | - |
Homo sapiens | tosyl-Gly-L-Pro-L-Arg + 4-nitroaniline | - |
? |