Information on EC 3.4.23.34 - cathepsin E

New: Word Map on EC 3.4.23.34
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Mark a special word or phrase in this record:
Search Reference ID:
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)


The expected taxonomic range for this enzyme is: Bilateria

EC NUMBER
COMMENTARY hide
3.4.23.34
-
RECOMMENDED NAME
GeneOntology No.
cathepsin E
REACTION
REACTION DIAGRAM
COMMENTARY hide
ORGANISM
UNIPROT
LITERATURE
similar to cathepsin D, but slightly broader specificity
show the reaction diagram
-
-
-
-
REACTION TYPE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
hydrolysis of peptide bond
CAS REGISTRY NUMBER
COMMENTARY hide
110910-42-4
-
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
physiological function
-
cathepsin E specifically induces growth arrest and apoptosis in a variety of human prostate cancer cell lines in vitro by catalyzing the proteolytic release of soluble tumor necrosis factor-related apoptosis-inducing ligand from tumor cell surface and prevents tumor growth and metastasis in vivo through multiple mechanisms, including induction of apoptosis angiogenesis inhibition and enhanced immune responses
SUBSTRATE
PRODUCT                       
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
fluorogenic synthetic substrate
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
show the reaction diagram
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Ser-Ala-Phe-Leu-Ala-Phe-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide + H2O
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu + L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
show the reaction diagram
-
due to the close proximity of a Mca-donor and a Dnp-acceptor, near complete intramolecular quenching effect is achieved in the substrate's intact state. After the proteolytic cleavage of the hydrophobic motif, both Mca and Dnp are further apart, resulting in bright fluorescence
substrate shows a 265fold difference in the net fluorescence signals between cathepsins E and D. This cathepsin E selectivity is established by having Leu-Pro residues at the scissile peptide bond
-
?
Acetyl-substance P + H2O
?
show the reaction diagram
-
-
-
-
-
Acetyl-substance P(2-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Acetyl-substance P(3-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Acidic fibroblast growth factor fragment 102-111 + H2O
His-Ala-Glu-Lys-His-Trp-Phe + Val-Gly-Leu
show the reaction diagram
antigens presented by MHC class II molecules + H2O
?
show the reaction diagram
-
-
-
?
Arg-modified substance P + H2O
?
show the reaction diagram
-
-
-
-
-
Basic fibroblast growth factor fragment 106-120 + H2O
?
show the reaction diagram
Bovine gamma-globulin + H2O
Hydrolyzed bovine gamma-globulin
show the reaction diagram
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
show the reaction diagram
casein + H2O
hydrolyzed casein
show the reaction diagram
Cholecystokinin 8 + H2O
Asp-Tyr-Met-Gly-Trp + Met-Asp-Phe-NH2
show the reaction diagram
Cytochrome c + H2O
Hydrolyzed cytochrome c
show the reaction diagram
-
pH 5, at 2.5% (dimeric enzyme) or 2.3% (monomeric enzyme) the rate of hemoglobin hydrolysis
-
-
DED-[5-[(2-aminoethyl)amino]naphthalene-1-sulfonyl]-KPILFFRLGK-[4-(4-dimethylaminophenylazo)benzoic acid] + H2O
?
show the reaction diagram
-
-
-
-
?
dynorphin A + H2O
hydrolyzed dynorphin A
show the reaction diagram
Egg albumin + H2O
Hydrolyzed egg albumin
show the reaction diagram
Eledoisin + H2O
Pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe + Ile-Gly-Leu-Met-NH2
show the reaction diagram
glucagon + ATP + H2O
hydrolyzed glucagon + ?
show the reaction diagram
-
is digested at pH 4.0 but not at pH 7.4
-
-
?
Hemoglobin + H2O
?
show the reaction diagram
-
denatured
-
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
Human beta-endorphin + H2O
Hydrolyzed human beta-endorphin
show the reaction diagram
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
show the reaction diagram
Human endothelin precursor big ET-2 + H2O
Human endothelin precursor ET-2 + respective C-terminal fragment
show the reaction diagram
-
cleavage site: Trp-Val
-
-
Human endothelin precursor big ET-3 + H2O
Huamn endothelin precursor ET-3 + respective C-terminal fragment
show the reaction diagram
-
cleavage site: Trp-Ile
-
-
Human gamma-globulin + H2O
Hydrolyzed human gamma-globulin
show the reaction diagram
-
pH 5, at 0.5% (dimeric enzyme) or 0.6% (monomeric enzyme) the rate of hemoglobin hydrolysis
-
-
Human renin substrate + H2O
Acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Val-Ile-His
show the reaction diagram
Immunoglobulin + H2O
?
show the reaction diagram
-
least active gastric protease for this substrate
-
-
-
Kassinin + H2O
Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe + Val-Gly-Leu-Met-NH2
show the reaction diagram
Lys-Pro-Ala-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ala-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
Membrane proteins + H2O
?
show the reaction diagram
-
-
-
-
-
MOCAc-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(DnP)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
?
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
show the reaction diagram
-
-
-
-
-
MOCAc-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(DNP)-D-Arg-NH2 + H2O
hydrolyzed MOCAc-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(DNP)-D-Arg-NH2
show the reaction diagram
-
-
-
-
-
N-succinyl-Arg-Pro-Phe-His-Leu-Leu-Val-Tyr-4-methyl-7-coumaryl-amide + H2O
?
show the reaction diagram
-
-
-
?
Neurokinin A + H2O
His-Lys-Thr-Asp-Ser-Phe + Val-Gly-Leu-Met-NH2
show the reaction diagram
neurotensin + H2O
hydrolyzed neurotensin
show the reaction diagram
-
no cleavage at pH 7.4
-
-
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
show the reaction diagram
Porcine renin substrate + H2O
Acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Leu-Val-Tyr-Ser
show the reaction diagram
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
Pro-Thr-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Thr-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Reduced and carboxymethylated bovine pancreatic ribonuclease A + H2O
Hydrolyzed bovine pancreatic RCm ribonuclease A
show the reaction diagram
-
-
-
-
reduced carboxymethylated(RCm-)ribonuclease A + H2O
?
show the reaction diagram
-
-
-
?
Substance P + H2O
Arg-Pro-Lys-Pro-Gln-Gln-Phe + Phe-Gly-Leu-Met-NH2
show the reaction diagram
Substance P(1-9) + H2O
?
show the reaction diagram
-
-
-
-
-
Substance P(2-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Substance P(3-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Substance P(4-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Tachykinins + H2O
?
show the reaction diagram
[His10]-substance P + H2O
?
show the reaction diagram
-
-
-
-
-
[Tyr8]-substance P + H2O
?
show the reaction diagram
-
-
-
-
-
additional information
?
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
additional information
?
-
COFACTOR
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
CTP
-
activation, maintains enzyme in its active conformation at pH 5 and above
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
additional information
-
no activation by Mg2+ or vanadate
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
(D)-His-Pro-Phe-His-Leu-PSI(CH2-NH)-Leu-Val-Tyr
1,2-epoxy-3-(p-nitrophenoxy)propane
alpha2-Macroglobulin
-
at pH 5.5, RNAse as substrate, at a molar ratio of enzyme/inhibitor of 0.5:1 to 2:1, above a ratio of 2:1 the excess enzyme is not inhibited, structural changes in alpha2-macroglobulin upon complex formation, no inhibition with oxidized insulin B-chain as substrate
-
Ascaris pepsin inhibitor
CCACCAACACAACTAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 4.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAACAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 31.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAACGAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 14.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAATAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCATCACTACAACAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCATAGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 22.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCATAGTGCTCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 6.2% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCCCACCACAACCCTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 37.6% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCCCACCACAACCCTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
DGCCIIIIGGRPPTHLFLD
-
DGCCIIINGGRPPTVFFRVKDYKHHDDK
-
Diazoacetyl-DL-norleucine methyl ester
GCGGLLPFGGQPPNPLF
-
GGSCSSCLGGRPPTIFFRLKDYKDDDDK
-
grassystatin A
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
grassystatin B
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
grassystatin C
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
IIIISCIGDDGHQKKKK
-
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
N-tert-Butoxycarbonyl-His-Pro-Phe-His-Leu-PSI(CHOH-CH2)-Val-Ile-His
NDDKIIIIPTIFGG
-
PepA-penetratin
Pepstatin
pepstatin A
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Nle-Arg-Leu
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Phe-Arg-Glu
Protein inhibitor from Ascaris lumbricoides
SCIGIIDSGGRPPTIFFRAEGLQR
-
TCCATAAGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.2% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGAATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 26.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGATTCACTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.7% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGCTCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 24.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGTCACTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 18.4% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGTATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 15.4% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGAGCTCACTCATCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 27.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGAGCTCACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGTGCTCACTTATCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 19.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TGCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 40.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
Tripeptide analogs
TTCATATGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TTCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 29.7% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
YCGGLLPLGGRPPTIFFRLKDYKGDDDK
-
additional information
ACTIVATING COMPOUND
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
6-(4-chlorophenyl)imidazo[2,1-b]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime
-
CITCO
GTP
-
activation, maintains enzyme in its active conformation at pH 5 and above
IGCEERSFPNIIIIIG
-
up to 260% activation of cythepsin E, KD value about 300 nM. Treatment of HeLa cells with cathepsin E and peptide results in decrease in cell viability, with a 1.5- and 3-fold increase in the level of apoptosis in comparison to cells treated with cathepsin E alone
PGIKPPPCIIIIG
-
up to 180% activation of cythepsin E
Phenobarbital
-
PB
SPIISHIVGCDPPSCG
-
up to 160% activation of cythepsin E
additional information
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
1.27 - 1.91
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
0.0032
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, gastric cathepsin E
0.0028
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, wild-type cathepsin E
0.00153 - 0.00228
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
0.00243
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Ser-Ala-Phe-Leu-Ala-Phe-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, gastric cathepsin E
1.94
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
-
pH 4.0, 27C
0.0093
Acetyl-substance P
-
pH 5
0.083
Acetyl-substance P(2-11)
-
pH 5
0.4
Acetyl-substance P(3-11)
-
-
0.143
acidic fibroblast growth factor
-
pH 5
-
0.009
big ET-1
0.008
big ET-2
-
-
0.02
big ET-3
-
-
0.0059
Eledoisin
-
pH 5
0.16
Lys-Pro-Ala-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
pH 3.1
0.04 - 0.4
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
0.0068
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
25C, pH 4.0
0.025
Neurokinin A
-
pH 5
0.03 - 0.13
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
0.145
Pro-Thr-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
pH 3.1
0.0034
renin
-
porcine substrate, pH 5
-
0.0023 - 0.0039
Substance P
0.5
Substance P(1-9)
-
value above
0.042
Substance P(2-11)
-
pH 5
0.66
Substance P(3-11)
-
-
0.024
Substance P(4-11)
-
pH 5
0.011
[His10]-substance P
-
pH 5
0.0071
[Tyr8]-substance P
-
pH 5
additional information
additional information
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
1.55 - 11.9
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
39.1
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, gastric cathepsin E
32.2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, wild-type cathepsin E
0.52 - 20.1
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
1.68
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Ser-Ala-Phe-Leu-Ala-Phe-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, gastric cathepsin E
322.5
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
Homo sapiens
-
pH 4.0, 27C
26
Acetyl-substance P
Cavia porcellus
-
pH 5
19
Acetyl-substance P(2-11)
Cavia porcellus
-
pH 5
58
Acetyl-substance P(3-11)
Cavia porcellus
-
pH 5
18
acidic fibroblast growth factor
Cavia porcellus
-
pH 5
-
64
Arg-modified substance P
Cavia porcellus
-
pH 5
-
0.13
big ET-1
0.1
big ET-2
Homo sapiens
-
-
0.14
big ET-3
Homo sapiens
-
-
10
Eledoisin
Cavia porcellus
-
pH 5
135
Lys-Pro-Ala-Glu-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
pH 3.1
26 - 170
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
360
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
Homo sapiens
-
25C, pH 4.0
42
Neurokinin A
Cavia porcellus
-
pH 5
13
Porcine renin substrate
Cavia porcellus
-
pH 5
5 - 132
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
27
Pro-Thr-Glu-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
pH 3.1
22
Substance P(2-11)
Cavia porcellus
-
pH 5
70
Substance P(3-11)
Cavia porcellus
-
pH 5
0.74
Substance P(4-11)
Cavia porcellus
-
pH 5
23
[His10]-substance P
Cavia porcellus
-
pH 5
40
[Tyr8]-substance P
Cavia porcellus
-
pH 5
additional information
additional information
kcat/KM VALUE [1/mMs-1]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
167
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
Homo sapiens
-
pH 4.0, 27C
41947
Ki VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
0.00001913
Ascaris pepsin ihibitor
-
pH 3.5, 40C, mutant D98E
-
0.0000112 - 0.00001953
Ascaris pepsin inhibitor
0.000014
NDDKIIIICCII
competitive
0.000003
NYKDSCIG
non-competitive
0.0000002 - 0.0000084
pepstatin A
0.000005
SCGGIIIISCIA
non-competitive
IC50 VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
0.0012
DGCCIIINGGRPPTVFFRVKDYKHHDDK
Rattus norvegicus
P16228
-
0.00084
GCGGLLPFGGQPPNPLF
Rattus norvegicus
P16228
-
0.0046
GGRPIIIIGG
Rattus norvegicus
P16228
-
0.00024
GGSCSSCLGGRPPTIFFRLKDYKDDDDK
Rattus norvegicus
P16228
-
0.000000886
grassystatin A
Homo sapiens
-
-
0.000000354
grassystatin B
Homo sapiens
-
-
0.0000429
grassystatin C
Homo sapiens
-
-
0.00024
IIIISCIGDDGHQKKKK
Rattus norvegicus
P16228
-
0.00028
NDDKIIIICCII
Rattus norvegicus
P16228
-
0.00026
NDDKIIIIPTIFGG
Rattus norvegicus
P16228
-
0.00068
NYKDSCIG
Rattus norvegicus
P16228
-
0.000000181
pepstatin A
Homo sapiens
-
-
0.00023
SCGGIIIISCIA
Rattus norvegicus
P16228
-
0.00032
SGLLFRLKGG
Rattus norvegicus
P16228
-
0.00038
YCGGLLPLGGRPPTIFFRLKDYKGDDDK
Rattus norvegicus
P16228
-
SPECIFIC ACTIVITY [µmol/min/mg]
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
2.2
-
hemoglobin as substrate, calculated on the basis of leucine equivalents released
additional information
pH OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
2 - 3.5
-
hemoglobin as substrate
2.5
-
approximate value, hemoglobin as substrate
2.5 - 3.6
-
hemoglobin as substrate
3
-
approximate value
3.3
-
big ET-3 as substrate
3.5 - 4.4
-
plateau, big ET-1 and 2 as substrates
3.5 - 4.5
-
-
7.4
-
assay at
additional information
pH RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
1 - 4
-
83% of maximal activity at pH 1 and 55% of maximal activity at pH 4, hemoglobin as substrate
1.6 - 3.9
-
half-maximal activity at pH 1.6 and 3.9, hemoglobin as substrate
2 - 4
-
90% of maximal activity at pH 2 and half-maximal activity at pH 4, hemoglobin as substrate
2 - 5
-
pH 2.0 and 5.0: approximately 80% of maximal activity
3.5 - 4.8
-
pH 3.5.-4.5: optimum, pH 4.8: about 25% of maximal activity
5 - 7
-
active in the presence of ATP
5.8
-
and above, no activity in the absence of ATP
additional information
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
pI VALUE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
SOURCE TISSUE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
SOURCE
-
primary hepatocyte cultures
Manually annotated by BRENDA team
-
high relative expression of catE in adenomas and carcinomas relative to normal epithelium
Manually annotated by BRENDA team
-
high relative expression of catE in adenomas and carcinomas relative to normal epithelium
Manually annotated by BRENDA team
-
-
Manually annotated by BRENDA team
-
human M cell
Manually annotated by BRENDA team
-
pancreas from normal, chronic pancreatitis and pancreatic ductal adenocarcinoma patients
Manually annotated by BRENDA team
-
cathepsin E is secreted by activated phagocytes
Manually annotated by BRENDA team
-
hepatocyte
Manually annotated by BRENDA team
-
proform of CE in the endoplasmic reticulum and the Golgi complex
Manually annotated by BRENDA team
-
increased catE levels in the urine of APC(Min/+) mice
Manually annotated by BRENDA team
additional information
LOCALIZATION
ORGANISM
UNIPROT
COMMENTARY hide
GeneOntology No.
LITERATURE
SOURCE
-
recombinant enzyme
Manually annotated by BRENDA team
-
recombinant enzyme in Escherichia coli
Manually annotated by BRENDA team
-
cathepsin E is located in mast-cell secretory granules in complex with heparin proteoglycans, and has a role in processing of procarboxypeptidase A into active protease
Manually annotated by BRENDA team
-
recombinant enzyme
Manually annotated by BRENDA team
additional information
PDB
SCOP
CATH
ORGANISM
UNIPROT
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
42000
-
mature cathepsin E, SDS-PAGE
46000
-
procathepsin E, SDS-PAGE
84000
-
human, recombinant enzyme, SDS-PAGE, non-reducing conditions
85000
-
human
88000
-
Rana catesbeiana, gel filtration
92000
-
dimer due to dimeric linkage between two monomers, non-denaturing PAGE
98000
-
rat, dimer CE-II, gel filtration
additional information
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
additional information
POSTTRANSLATIONAL MODIFICATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
glycoprotein
proteolytic modification
-
propeptide of cathepsin E is essential for the correct folding, maturation, and targeting of this protein to its final destination
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
sitting drop vapor diffusion, crystal structure of an activation intermediate of cathepsin E at 2.35 A resolution. The overall structure follows the general fold of aspartic proteases of the A1 family, and the intermediate shares many features with the intermediate 2 on the proposed activation pathway of aspartic proteases like pepsin C and cathepsin D. The pro-sequence is cleaved from the protease and remains stably associated with the mature enzyme by forming the outermost sixth strand of the interdomain beta-sheet
-
pH STABILITY
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
3 - 5.5
-
6 h at 37C, unstable
30800
4
-
2 h at 28C, 60-65% loss of activity
30789
5
-
2 h at 28C, 45% (dimer) and 55% (monomer) loss of activity
30789
6
-
2 h at 28C, 20% loss of activity
30789
6 - 7.4
-
6 h at 37C, rather stable
30800
7
-
2 h at 28C, stable (dimer), 10% loss of activity (monomer)
30789
7.5
-
2 h at 28C, 50% loss of monomeric enzyme activity
30789
8
-
2 h at 28C, 10% (dimer) and 70% (monomer) loss of activity
30789
8.8
-
2 h at 28C, 20% (dimer) and 95% (monomer) loss of activity
30789
additional information
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
25
-
and below, stable, t1/2: more than 3 h at pH 9.5
28
-
2 h, enzyme dimer: 60% loss of activity at pH 4, 45% at pH 5, 20% at pH 6 and pH 8.8, stable at pH 7, 10% loss of activity at pH 8, enzyme monomer: 65% loss of activity at pH 4, 55% at pH 5, 20% at pH 6, 10% at pH 7, 50% at pH 7.5, 70% at pH 8 and 95% at pH 8.8
45
-
t1/2: 40 min at pH 8.5
60
-
1 h, 10% loss of activity
additional information
GENERAL STABILITY
ORGANISM
UNIPROT
LITERATURE
ATP, CTP or GTP stabilizes in the range of pH 5-7.4, not below pH 5, adenosine, sodium triphosphate, ADP, 2,3-diphosphoglycerate do not stabilize
-
Freezing inactivates, 50% glycerol stabilizes
-
STORAGE STABILITY
ORGANISM
UNIPROT
LITERATURE
-20C, procathepsin E, in neutral or weakly alkaline solution with 50% glycerol, several months, cathepsin E is stable under the same conditions provided the pH-value of the storage solution is kept around pH 5.5
-
0C, at pH 8, several months, with some autodigestion
-
4C, procathepsin E, stable in saturated solution of ammonium sulfate adjusted to neutral or weakly alkaline pH, cathepsin E is stable under the same conditions provided the pH-value of the storage solution is kept around pH 5.5
-
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
2 catalytically active forms CE-I and CE-II; gastric enzyme
-
2 isozymes
-
affinity chromatography
-
as procathepsin E
-
as procathepsin E from spleen
-
as procathepsin E with following activation by lowering the pH-value of the solution to 4
-
DEAE-Sephacel chromatography and immunodepletion
-
immunoaffinity chromatography
-
monomeric form
-
recombinant
-
recombinant from heterologous Chinese hamster ovary cells (3 forms: cytosolic s-CE and vacuolar v-CE-1 and 2)
-
recombinant from Pichia pastoris
-
wild-type and T284S and D98E mutant proteins
-
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
construction of two fusion proteins using chimeric DNAs encoding the cathepsin E propeptide fused to the mature cathepsin D tagged with HA at the COOH terminus and encoding the cathepsin D propeptide fused to the mature cathepsin E
-
expressed in Chinese hamster ovary cells
-
expressed in Chinese hamster ovary cells; human; procathepsin E
-
expressed in Escherichia coli BL21(DE3)pLysS; human
-
expressed in Pichia pastoris cells; human
-
expression in HEK293T cells of wild-type and mutant form
-
guinea pig; human; rabbit
guinea pig; procathepsin E
-
HEK-293 cells are transfected with the full length human cathepsin E gene cloned into pcDNA3.1V5His
-
heterologously expressed in human embryonic kidney 293T cells
-
human (gastric adenocarcinoma)
-
human pro-cathepsin E is expressed in Escherichia coli in the form of inclusion bodies. The protein is dissolved in 8 M guanidinium chloride and refolded by dilution/dialysis. The main side products in the refolding reaction were soluble, high molecular mass protein complexes linked most likely due to formation of wrong intra- and intermolecular disulfide bonds. Pro-cathepsin E auto-activates at pH 3.5. The major part of the high molecular mass complexes is easily removed during the auto-activation process as these protein components precipitate during the pH shifts
-
mutants with changed active-site residues and lacking propeptides and N-glycosylation, expressed in human embryonic kidney 293T cells
-
stable expression in human prostate carcinoma cell line ALVA101, product is named ALVA101/hCE
-
EXPRESSION
ORGANISM
UNIPROT
LITERATURE
cathepsin E mRNA is highly upregulated in a human pancreatic ductal adenocarcinoma and pancreatic intraepithelial neoplasia lesions as well as in genetically engineered mouse models of pancreatic cancer
-
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
D98A/D283A
-
expression in HEK293T cells
D283A
-
site-directed mutagenesis
D283E
-
site-directed mutagenesis
D98A
-
site-directed mutagenesis
D98A/D283A
D98E
-
site-directed mutagenesis
D98E/D283E
-
double mutant, site-directed mutagenesis
N324D
-
N-glycosylation-deficient mutant is neither processed into a mature form nor transported to the endosomal compartement, but is stable retained in the endoplasmic reticulum without degradation
N92Q
-
N-glycosylation-deficient mutant is neither processed into a mature form nor transported to the endosomal compartement, but is stable retained in the endoplasmic reticulum without degradation
N92Q/N374D
-
N-glycosylation-deficient mutant is neither processed into a mature form nor transported to the endosomal compartement, but is stable retained in the endoplasmic reticulum without degradation
T284S
-
site-directed mutagenesis
additional information
-
construction of two fusion proteins using chimeric DNAs encoding the cathepsin E propeptide fused to the mature cathepsin D tagged with HA at the COOH terminus and encoding the cathepsin D propeptide fused to the mature cathepsin E
APPLICATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
medicine
molecular biology
-
CatE is a potential cancer biomarker
additional information