Information on EC 3.4.23.34 - cathepsin E

New: Word Map on EC 3.4.23.34
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Mark a special word or phrase in this record:
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)


The expected taxonomic range for this enzyme is: Bilateria

EC NUMBER
COMMENTARY
3.4.23.34
-
RECOMMENDED NAME
GeneOntology No.
cathepsin E
-
REACTION
REACTION DIAGRAM
COMMENTARY
ORGANISM
UNIPROT
LITERATURE
similar to cathepsin D, but slightly broader specificity
show the reaction diagram
-
-
-
-
REACTION TYPE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
hydrolysis of peptide bond
-
-
-
-
hydrolysis of peptide bond
-
-
SYNONYMS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
CatE
-
-
CatE
-
catE deficient mice develop atopic dermatitis-like skin lesions
Cathepsin D-like acid proteinase
-
-
-
-
cathepsin D-like aspartic proteinase
-
cathepsin D-like protease
-
-
Cathepsin D-type proteinase
-
-
-
-
cathepsin E
-
-
cathepsin E
-
cathepsin E
-
-
Cathepsin E-like acid proteinase
-
-
-
-
CTSE
-
-
EMAP
-
-
-
-
erythrocyte membrane acid proteinase
-
-
Erythrocyte membrane aspartic proteinase
-
-
-
-
Non-pepsin proteinase
-
-
-
-
slow moving proteinase
-
-
Slow-moving proteinase
-
-
-
-
SMP
-
-
-
-
gastric mucosa non-pepsin acid proteinase
-
-
additional information
-
current names and systematic
CAS REGISTRY NUMBER
COMMENTARY
110910-42-4
-
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
physiological function
-
cathepsin E specifically induces growth arrest and apoptosis in a variety of human prostate cancer cell lines in vitro by catalyzing the proteolytic release of soluble tumor necrosis factor-related apoptosis-inducing ligand from tumor cell surface and prevents tumor growth and metastasis in vivo through multiple mechanisms, including induction of apoptosis angiogenesis inhibition and enhanced immune responses
SUBSTRATE
PRODUCT                      
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
fluorogenic synthetic substrate
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2
show the reaction diagram
-
-
-
-
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(dinitrophenyl)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
show the reaction diagram
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
most sensitive and selective substrate for cathepsin E. This substrate might represent a useful tool for monitoring and accurately quantifying cathepsin E, even in crude enzyme preparations
-
-
?
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Ser-Ala-Phe-Leu-Ala-Phe-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide + H2O
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu + L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
show the reaction diagram
-
due to the close proximity of a Mca-donor and a Dnp-acceptor, near complete intramolecular quenching effect is achieved in the substrate's intact state. After the proteolytic cleavage of the hydrophobic motif, both Mca and Dnp are further apart, resulting in bright fluorescence
substrate shows a 265fold difference in the net fluorescence signals between cathepsins E and D. This cathepsin E selectivity is established by having Leu-Pro residues at the scissile peptide bond
?
Acetyl-substance P + H2O
?
show the reaction diagram
-
-
-
-
-
Acetyl-substance P(2-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Acetyl-substance P(3-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Acidic fibroblast growth factor fragment 102-111 + H2O
His-Ala-Glu-Lys-His-Trp-Phe + Val-Gly-Leu
show the reaction diagram
-
i.e. His-Ala-Glu-Lys-His-Trp-Phe-Val-Gly-Leu or acidic FGF 102-111
-
-
antigens presented by MHC class II molecules + H2O
?
show the reaction diagram
-
-
-
-
?
Arg-modified substance P + H2O
?
show the reaction diagram
-
-
-
-
-
Basic fibroblast growth factor fragment 106-120 + H2O
?
show the reaction diagram
-
i.e. Tyr-Arg-Ser-Arg-Lys-Tyr-Ser-Ser-Trp-Tyr-Val-Ala-Leu-Lys-Arg or basic FGF 106-120, major cleavage site: Tyr-Val, minor site: Trp-Tyr
-
-
-
Bovine gamma-globulin + H2O
Hydrolyzed bovine gamma-globulin
show the reaction diagram
-
-
-
-
Bovine gamma-globulin + H2O
Hydrolyzed bovine gamma-globulin
show the reaction diagram
-
pH 2.5, at 2.3% the rate of hemoglobin hydrolysis
-
-
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
show the reaction diagram
-
-
-
-
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
show the reaction diagram
-
pH 2.5 at 14% the rate of hemoglobin hydrolysis
-
-
Bovine serum albumin + H2O
Hydrolyzed bovine serum albumin
show the reaction diagram
-
pH 5, at 3.6% (dimeric enzyme) or 4.1% (monomeric enzyme) the rate of hemoglobin hydrolysis
-
-
casein + H2O
hydrolyzed casein
show the reaction diagram
-
-
-
-
casein + H2O
hydrolyzed casein
show the reaction diagram
-
-
-
-
casein + H2O
hydrolyzed casein
show the reaction diagram
-
-
-
-
casein + H2O
hydrolyzed casein
show the reaction diagram
-
at 2.3% the rate of hemoglobin hydrolysis
-
-
casein + H2O
hydrolyzed casein
show the reaction diagram
-
pH 5, at 9.1% (dimeric enzyme) or 8.9% (monomeric enzyme) the rate of hemoglobin hydrolysis
-
-
casein + H2O
hydrolyzed casein
show the reaction diagram
-
at pH 5.5
-
-
Cholecystokinin 8 + H2O
Asp-Tyr-Met-Gly-Trp + Met-Asp-Phe-NH2
show the reaction diagram
-
i.e. Asp-Tyr-Met-Gly-Trp-Met-Asp-Phe-NH2, cleavage site: Trp-Met
-
-
Cytochrome c + H2O
Hydrolyzed cytochrome c
show the reaction diagram
-
pH 5, at 2.5% (dimeric enzyme) or 2.3% (monomeric enzyme) the rate of hemoglobin hydrolysis
-
-
DED-[5-[(2-aminoethyl)amino]naphthalene-1-sulfonyl]-KPILFFRLGK-[4-(4-dimethylaminophenylazo)benzoic acid] + H2O
?
show the reaction diagram
-
-
-
-
?
dynorphin A + H2O
hydrolyzed dynorphin A
show the reaction diagram
-
cleavage site: Phe4-Leu5
-
-
dynorphin A + H2O
hydrolyzed dynorphin A
show the reaction diagram
-
no cleavage at pH 7.4
-
?
Egg albumin + H2O
Hydrolyzed egg albumin
show the reaction diagram
-
pH 5, at 1% (dimeric enzyme) or 1.1% (monomeric enzyme) the rate of hemoglobin hydrolysis
-
-
Egg albumin + H2O
Hydrolyzed egg albumin
show the reaction diagram
-
i.e. ovalbumin
-
-
Eledoisin + H2O
Pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe + Ile-Gly-Leu-Met-NH2
show the reaction diagram
-
i.e. pyro-Glu-Pro-Ser-Lys-Asp-Ala-Phe-Ile-Gly-Leu-Met-NH2, cleavage site: Phe-Ile
-
-
glucagon + ATP + H2O
hydrolyzed glucagon + ?
show the reaction diagram
-
is digested at pH 4.0 but not at pH 7.4
-
?
Hemoglobin + H2O
?
show the reaction diagram
-
denatured
-
-
?
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
-
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
-
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
-
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
-
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
-
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
-
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
-
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
acid denatured form
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
acid denatured form
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
acid denatured form
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
acid denatured form
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
acid denatured form
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
preferred substrate
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
preferred substrate
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
at pH 2 the two catalytically active subunits have the same activity vs. hemoglobin, but at pH 5 they have a slightly higher activity than the enzyme dimer
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
bovine
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
bovine
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
bovine
-
-
Hemoglobin + H2O
Hydrolyzed hemoglobin
show the reaction diagram
-
bovine
-
-
Human beta-endorphin + H2O
Hydrolyzed human beta-endorphin
show the reaction diagram
-
major cleavage site: Leu17-Phe18, minor site: Thr16-Leu17
-
-
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
show the reaction diagram
-
cleavage site: Trp-Val
-
-
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
show the reaction diagram
-
cleavage site: Trp-Val
-
-
Human endothelin precursor big ET-1 + H2O
Human endothelin precursor ET-1 + respective C-terminal fragment
show the reaction diagram
-
cleavage site: Trp-Val
-
-
Human endothelin precursor big ET-2 + H2O
Human endothelin precursor ET-2 + respective C-terminal fragment
show the reaction diagram
-
cleavage site: Trp-Val
-
-
Human endothelin precursor big ET-3 + H2O
Huamn endothelin precursor ET-3 + respective C-terminal fragment
show the reaction diagram
-
cleavage site: Trp-Ile
-
-
Human gamma-globulin + H2O
Hydrolyzed human gamma-globulin
show the reaction diagram
-
pH 5, at 0.5% (dimeric enzyme) or 0.6% (monomeric enzyme) the rate of hemoglobin hydrolysis
-
-
Human renin substrate + H2O
Acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Val-Ile-His
show the reaction diagram
-
i.e. angiotensinogen fragment 1-13 or Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu-Val-Ile-His, cleavage site: Leu-Val
-
-
Immunoglobulin + H2O
?
show the reaction diagram
-
least active gastric protease for this substrate
-
-
-
Kassinin + H2O
Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe + Val-Gly-Leu-Met-NH2
show the reaction diagram
-
i.e. Asp-Val-Pro-Lys-Ser-Asp-Gln-Phe-Val-Gly-Leu-Met-NH2, cleavage site: Phe-Val
-
-
Lys-Pro-Ala-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ala-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
synthetic chromogenic peptide, less suitable peptide substrate than substance P or other tachykinins
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
pH 7.4, no activation by ATP
-
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Lys-Pro-Ile-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
i.e. RS-6
-
-
Membrane proteins + H2O
?
show the reaction diagram
-
-
-
-
-
MOCAc-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(DnP)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
?
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
?
show the reaction diagram
-
-
-
-
?
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe + Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
show the reaction diagram
-
-
-
-
N-succinyl-Arg-Pro-Phe-His-Leu-Leu-Val-Tyr-4-methyl-7-coumaryl-amide + H2O
?
show the reaction diagram
-
-
-
?
Neurokinin A + H2O
His-Lys-Thr-Asp-Ser-Phe + Val-Gly-Leu-Met-NH2
show the reaction diagram
-
i.e. His-Lys-Thr-Asp-Ser-Phe-Val-Gly-Leu-Met-NH2, cleavage site: Phe-Val
-
-
neurotensin + H2O
hydrolyzed neurotensin
show the reaction diagram
-
no cleavage at pH 7.4
-
?
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
show the reaction diagram
-
-
-
-
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
show the reaction diagram
-
cleavage sites
-
-
Oxidized insulin B-chain + H2O
Hydrolyzed oxidized insulin B-chain
show the reaction diagram
-
no activation by ATP, cleavage specificity changes significantly with pH, e.g. cleaves Glu13-Ala14 only at pH 7.4
-
-
Porcine renin substrate + H2O
Acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu + Leu-Val-Tyr-Ser
show the reaction diagram
-
i.e. angiotensinogen fragment 1-14 acetate salt or acetyl-Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu-Leu-Val-Tyr-Ser, cleavage site: Leu-Leu
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
synthetic chromogenic peptide
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
synthetic chromogenic peptide
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
synthetic chromogenic peptide
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
synthetic chromogenic peptide
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
synthetic chromogenic peptide
-
-
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Pro-Thr-Ile-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
synthetic chromogenic peptide
-
-
Pro-Thr-Glu-Phe-(4-nitro)Phe-Arg-Leu + H2O
Pro-Thr-Glu-Phe + (4-nitro)Phe-Arg-Leu
show the reaction diagram
-
-
-
-
Reduced and carboxymethylated bovine pancreatic ribonuclease A + H2O
Hydrolyzed bovine pancreatic RCm ribonuclease A
show the reaction diagram
-
-
-
-
reduced carboxymethylated(RCm-)ribonuclease A + H2O
?
show the reaction diagram
-
-
-
-
?
Substance P + H2O
Arg-Pro-Lys-Pro-Gln-Gln-Phe + Phe-Gly-Leu-Met-NH2
show the reaction diagram
-
i.e. Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2, best peptide substrate, cleavage site: Phe-Phe
-
-
Substance P(1-9) + H2O
?
show the reaction diagram
-
-
-
-
-
Substance P(2-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Substance P(3-11) + H2O
?
show the reaction diagram
-
-
-
-
-
Substance P(4-11) + H2O
?
show the reaction diagram
-
-
-
-
-
[His10]-substance P + H2O
?
show the reaction diagram
-
-
-
-
-
[Tyr8]-substance P + H2O
?
show the reaction diagram
-
-
-
-
-
MOCAc-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(DNP)-D-Arg-NH2 + H2O
hydrolyzed MOCAc-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(DNP)-D-Arg-NH2
show the reaction diagram
-
-
-
-
additional information
?
-
-
no hydrolysis of synthetic peptides corresponding to residues His16-His27 and His16-Ser38 in the big ET-1 sequence
-
-
-
additional information
?
-
-
milk-clotting activity is twice as high as that of pepsinogen and gastricin
-
-
-
additional information
?
-
-
degradation of protein antigens, crucial step in the initiation of a T-cell mediated immune response
-
-
?
additional information
?
-
-
cathepsin E has an important role in the class II MHC Ag processing pathway within dendritic cells
-
-
-
additional information
?
-
-
cathepsin E is located in mast-cell secretory granules in complex with heparin proteoglycans, and has a role in processing of procarboxypeptidase A into active protease
-
-
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
additional information
?
-
-
degradation of protein antigens, crucial step in the initiation of a T-cell mediated immune response
-
-
?
additional information
?
-
-
cathepsin E has an important role in the class II MHC Ag processing pathway within dendritic cells
-
-
-
additional information
?
-
-
cathepsin E is located in mast-cell secretory granules in complex with heparin proteoglycans, and has a role in processing of procarboxypeptidase A into active protease
-
-
-
COFACTOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
ATP
-
activation; maintains enzyme in its active conformation at pH 5 and above; no activation at low pH-values, e.g. pH 4.5
ATP
-
no activation at pH 7.4
ATP
-
6.25 mM; activation; hemoglobin as substrate; no activation of casein hydrolysis at pH 5.5
ATP
-
activates native, not recombinant enzyme; activation
CTP
-
activation, maintains enzyme in its active conformation at pH 5 and above
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
additional information
-
no activation by Mg2+ or vanadate
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
(D)-His-Pro-Phe-His-Leu-PSI(CH2-NH)-Leu-Val-Tyr
-
i.e. H-77, with reduced isostere as replacement of the-CO-NH- of the peptide bond
(D)-His-Pro-Phe-His-Leu-PSI(CH2-NH)-Leu-Val-Tyr
-
i.e. H-77, with reduced isostere as replacement of the-CO-NH- of the peptide bond
1,2-epoxy-3-(p-nitrophenoxy)propane
-
ir
alpha2-Macroglobulin
-
at pH 5.5, RNAse as substrate, at a molar ratio of enzyme/inhibitor of 0.5:1 to 2:1, above a ratio of 2:1 the excess enzyme is not inhibited, structural changes in alpha2-macroglobulin upon complex formation, no inhibition with oxidized insulin B-chain as substrate
-
Ascaris pepsin inhibitor
-
-
-
Ascaris pepsin inhibitor
-
-
-
Ascaris pepsin inhibitor
-
-
-
CCACCAACACAACTAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 4.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAACAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 31.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAACGAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 14.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCACCACCACAATAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCATCACTACAACAAAACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCATAGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 22.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCATAGTGCTCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 6.2% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCCCACCACAACCCTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 37.6% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
CCCCCACCACAACCCTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
DGCCIIIIGGRPPTHLFLD
-
DGCCIIINGGRPPTVFFRVKDYKHHDDK
-
Diazoacetyl-DL-norleucine methyl ester
-
ir
GCGGLLPFGGQPPNPLF
-
GGSCSSCLGGRPPTIFFRLKDYKDDDDK
-
grassystatin A
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
grassystatin B
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
grassystatin C
-
potent cathepsin E inhibitor, shows selectivity for cathepsin E over cathepsin D
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
-
-
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
-
i.e. L-363,564, hemoglobin as substrate
N-tert-Butoxycarbonyl-His-Pro-Phe-His-4-amino-3-hydroxy-6-methylheptanoic acid-Leu-Phe-NH2
-
-
N-tert-Butoxycarbonyl-His-Pro-Phe-His-Leu-PSI(CHOH-CH2)-Val-Ile-His
-
i.e. H-261, with reduced isostere as replacement of the -CO-NH- of the peptide bond
NDDKIIIIPTIFGG
-
PepA-penetratin
-
efficient cell-permeable aspartic protease inhibitor
-
Pepstatin
-
as substrate, incubation at pH 7.4 restores; at pH 3 and 5.5, not at pH 7.4
Pepstatin
-
hemoglobin
Pepstatin
-
-
Pepstatin
-
-
Pepstatin
-
as substrate, incubation at pH 7.4 restores; at pH 3 and 5.5, not at pH 7.4; oxidized insulin B-chain
Pepstatin
-
also inhibits conversion of procathepsin E to cathepsin E
pepstatin A
-
pepA
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Nle-Arg-Leu
-
i.e. H-297, with reduced isostere as replacement of the -CO-NH- of the peptide bond
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Nle-Arg-Leu
-
hemoglobin as substrate
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Nle-Arg-Leu
-
-
Pro-Thr-Glu-Phe-PSI(CH2-NH)-Phe-Arg-Glu
-
i.e. H-256, with reduced isostere as replacement of the -CO-NH- of the peptide bond
Protein inhibitor from Ascaris lumbricoides
-
MW 17000
-
Protein inhibitor from Ascaris lumbricoides
-
MW 17000
-
Protein inhibitor from Ascaris lumbricoides
-
MW 17000
-
SCIGIIDSGGRPPTIFFRAEGLQR
-
TCCATAAGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.2% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGAATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 26.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGATTCACTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.7% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGCTCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 24.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGGTCACTCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 18.4% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATAGGTATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 15.4% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGAGCTCACTCATCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 27.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGAGCTCACTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.5% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TCCCCGGTGCTCACTTATCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 19.3% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TGCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 40.8% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TTCATATGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.0% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
TTCATCGGGATCACTCCCTCCAC
-
inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 29.7% inhibition (2 nM inhibitor /2 nM cathepsin E)
-
YCGGLLPLGGRPPTIFFRLKDYKGDDDK
-
IIIISCIGDDGHQKKKK
-
additional information
-
iodoaceteic acid, EDTA, phosphoramidon on proteolysis of membrane proteins; no (or little) inhibition
-
additional information
-
2-mercaptoethanol, Mg2+ or vanadate
-
additional information
-
1,10-phenanthroline, diprotin A, antipain, amastatin, L-trans-epoxysuccinyl-leucylamido-(4-guanidino)-butane (i.e. E-64, at pH 7.4); inhibition by PMSF, diisopropyl fluorophosphate, leupeptin
-
additional information
-
the computed three-dimensional structure of cathepsin-E and the relevant findings might provide useful insights for designing inhibitors with the desired selectivity
-
ACTIVATING COMPOUND
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
6-(4-chlorophenyl)imidazo[2,1-b]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime
-
CITCO
GTP
-
activation, maintains enzyme in its active conformation at pH 5 and above
PGIKPPPCIIIIG
-
up to 180% activation of cythepsin E
-
Phenobarbital
-
PB
SPIISHIVGCDPPSCG
-
up to 160% activation of cythepsin E
-
IGCEERSFPNIIIIIG
-
up to 260% activation of cythepsin E, KD value about 300 nM. Treatment of HeLa cells with cathepsin E and peptide results in decrease in cell viability, with a 1.5- and 3-fold increase in the level of apoptosis in comparison to cells treated with cathepsin E alone
-
additional information
-
No activation of native enzyme by DTT; or 2-mercaptoethanol
-
additional information
-
or 2-mercaptoethanol
-
additional information
-
the catalytically inactive proenzyme procathepsin E is rapidly converted to the active enzyme cathepsin E after brief treatment at pH 4 by autoproteolytic cleavage at Met36-Ile37 and Phe39-Thr40 to form two mature isozymic forms
-
additional information
-
mechanism of proenzyme activation
-
additional information
-
screening for cathepsin E-activity-enhancing peptides functioning in the physiological pH range as potential cancer therapeutic candidates
-
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
1.27
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
-
pH 3.5, 40C, wild-type
1.31
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
-
pH 3.5, 40C, mutant D98E
1.91
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
-
pH 3.5, 40C, mutant T284S
0.0032
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, gastric cathepsin E
0.0028
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, wild-type cathepsin E
0.00153
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, wild-type cathepsin E
0.00179
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, gastric cathepsin E
0.0019
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, erythrocyte cathepsin E
0.00228
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, erythrocyte cathepsin E
0.00243
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Ser-Ala-Phe-Leu-Ala-Phe-Lys(Dnp)-D-Arg-NH2
-
40C, pH 4.0, gastric cathepsin E
1.94
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
-
pH 4.0, 27C
0.0093
Acetyl-substance P
-
pH 5
-
0.083
Acetyl-substance P(2-11)
-
pH 5
0.4
Acetyl-substance P(3-11)
-
-
0.143
acidic fibroblast growth factor
-
pH 5
-
0.009
big ET-1
-
pH 4.3
0.009
big ET-1
-
-
0.008
big ET-2
-
-
0.02
big ET-3
-
-
0.0059
Eledoisin
-
pH 5
0.16
Lys-Pro-Ala-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
pH 3.1
0.04
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
0.04
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
C4A mutant cathepsin E, pH 3.1
0.06
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
-
0.07
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
pH 3.5
0.09 - 0.4
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
recombinant enzyme forms
0.025
Neurokinin A
-
pH 5
0.03
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
-
pH 3.5
0.045
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
-
C4A mutant cathepsin E, pH 3.1
0.065
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
-
-
0.08
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
-
-
0.1 - 0.11
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
-
recombinant enzyme form
0.13
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
-
-
0.145
Pro-Thr-Glu-Phe-(4-nitro)Phe-Arg-Leu
-
pH 3.1
0.0034
renin
-
porcine substrate, pH 5
-
0.0023
Substance P
-
Arg-modified, pH 5
0.0039
Substance P
-
pH 5
0.5
Substance P(1-9)
-
value above
0.042
Substance P(2-11)
-
pH 5
0.66
Substance P(3-11)
-
-
0.024
Substance P(4-11)
-
pH 5
0.011
[His10]-substance P
-
pH 5
0.0071
[Tyr8]-substance P
-
pH 5
0.0068
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
-
25C, pH 4.0
additional information
additional information
-
pH-dependence of kinetic constants
-
additional information
additional information
-
kinetic parameters of peptide hydrolysis of cathepsin E and pepsin
-
additional information
additional information
-
apparent Km-values of hemoglobin hydrolysis
-
additional information
additional information
-
recombinant enzyme is catalytically indistinguishable from natural cathepsin
-
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
1.55
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
Rattus norvegicus
-
pH 3.5, 40C, mutant D98E
6.4
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
Rattus norvegicus
-
pH 3.5, 40C, mutant T284S
11.9
(7-methoxycoumarin-4)-acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(2,4-dinitrophenyl)-D-Arg-NH2 + H2O
Rattus norvegicus
-
pH 3.5, 40C, wild-type
39.1
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Ile-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, gastric cathepsin E
32.2
(7-methoxycoumarin-4-yl)acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, wild-type cathepsin E
0.52
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, wild-type cathepsin E
13.58
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, wild-type cathepsin E
18.8
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, erythrocyte cathepsin E
19.4
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
Homo sapiens
-
40C, pH 4.0, erythrocyte cathepsin E
20.1
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, gastric cathepsin E
1.68
(7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Ser-Ala-Phe-Leu-Ala-Phe-Lys(Dnp)-D-Arg-NH2
Rattus norvegicus
-
40C, pH 4.0, gastric cathepsin E
322.5
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
Homo sapiens
-
pH 4.0, 27C
26
Acetyl-substance P
Cavia porcellus
-
pH 5
-
19
Acetyl-substance P(2-11)
Cavia porcellus
-
pH 5
58
Acetyl-substance P(3-11)
Cavia porcellus
-
pH 5
18
acidic fibroblast growth factor
Cavia porcellus
-
pH 5
-
64
Arg-modified substance P
Cavia porcellus
-
pH 5
-
0.13
big ET-1
Cavia porcellus
-
pH 4.3
0.13
big ET-1
Homo sapiens
-
-
0.1
big ET-2
Homo sapiens
-
-
0.14
big ET-3
Homo sapiens
-
-
10
Eledoisin
Cavia porcellus
-
pH 5
135
Lys-Pro-Ala-Glu-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
pH 3.1
26
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
without ATP, pH 5.4
54
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
without ATP, pH 5
56
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 5.8
72
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 5.4
76
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
without ATP, pH 4.5
77
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 4.5 and pH 5
82
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
Cys4-Ala mutant cathepsin E, pH 3.1
115
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
-
170
Lys-Pro-Ile-Glu-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
pH 3.5
42
Neurokinin A
Cavia porcellus
-
pH 5
13
Porcine renin substrate
Cavia porcellus
-
pH 5
5
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
value below, with ATP, pH 7
11
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 6.6 and without ATP, pH 5
16
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 6.2
31
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 5
36
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
without ATP, pH 4.5
39
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 4.5 and pH 5.4
40
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
with ATP, pH 5.8
40
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
[Tyr8]-substance P, pH 5
40
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
-
47
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
without ATP, pH 5
47
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
substance P
47
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
-
70
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
Cys4-Ala mutant cathepsin E, pH 3.1
75
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
pH 3.5
132
Pro-Pro-Thr-Ile-Phe-(4-nitro)Phe-Arg-Leu
Homo sapiens
-
-
27
Pro-Thr-Glu-Phe-(4-nitro)Phe-Arg-Leu
Cavia porcellus
-
pH 3.1
22
Substance P(2-11)
Cavia porcellus
-
pH 5
70
Substance P(3-11)
Cavia porcellus
-
pH 5
0.74
Substance P(4-11)
Cavia porcellus
-
pH 5
23
[His10]-substance P
Cavia porcellus
-
pH 5
40
[Tyr8]-substance P
Cavia porcellus
-
pH 5
360
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2
Homo sapiens
-
25C, pH 4.0
additional information
additional information
Homo sapiens, Rattus norvegicus
-
pH-dependence of kinetic constants
-
additional information
additional information
Homo sapiens
-
pH-dependence of kinetic constants
-
kcat/KM VALUE [1/mMs-1]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
167
(7-methoxycoumarin-4-yl)acetyl-L-Ala-Gly-L-Phe-L-Ser-L-Leu-L-Pro-L-Ala-L-Lys(Dnp)-D-Arg-amide
Homo sapiens
-
pH 4.0, 27C
41947
Ki VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.00001913
Ascaris pepsin ihibitor
-
pH 3.5, 40C, mutant D98E
-
0.0000112
Ascaris pepsin inhibitor
-
40C, pH 4.0, erythrocyte cathepsin E, hydrolysis of (7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
-
0.0000135
Ascaris pepsin inhibitor
-
40C, pH 4.0, wild-type cathepsin E
-
0.0000145
Ascaris pepsin inhibitor
-
40C, pH 4.0, erythrocyte cathepsin E, hydrolysis of (7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
-
0.0000165
Ascaris pepsin inhibitor
-
40C, pH 4.0, gastric cathepsin E, hydrolysis of (7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
-
0.00001834
Ascaris pepsin inhibitor
-
pH 3.5, 40C, wild-type
-
0.00001953
Ascaris pepsin inhibitor
-
pH 3.5, 40C, mutant T284S
-
0.000014
NDDKIIIICCII
competitive
0.000003
NYKDSCIG
non-competitive
0.0000002
pepstatin A
-
25C, pH 4.0
0.0000031
pepstatin A
-
40C, pH 4.0, wild-type cathepsin E
0.0000056
pepstatin A
-
40C, pH 4.0, erythrocyte cathepsin E, hydrolysis of (7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
0.00000582
pepstatin A
-
pH 3.5, 40C, wild-type
0.00000606
pepstatin A
-
pH 3.5, 40C, mutant D98E
0.00000648
pepstatin A
-
pH 3.5, 40C, mutant T284S
0.0000078
pepstatin A
-
40C, pH 4.0, gastric cathepsin E, hydrolysis of (7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
0.0000084
pepstatin A
-
40C, pH 4.0, erythrocyte cathepsin E, hydrolysis of (7-methoxycoumarin-4-yl)acetyl-Gly-Ser-Pro-Ala-Phe-Leu-Ala-Lys(Dnp)-D-Arg-NH2
0.000005
SCGGIIIISCIA
non-competitive
IC50 VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.0012
DGCCIIINGGRPPTVFFRVKDYKHHDDK
Rattus norvegicus
P16228
-
0.00084
GCGGLLPFGGQPPNPLF
Rattus norvegicus
P16228
-
0.0046
GGRPIIIIGG
Rattus norvegicus
P16228
-
0.00024
GGSCSSCLGGRPPTIFFRLKDYKDDDDK
Rattus norvegicus
P16228
-
0.000000886
grassystatin A
Homo sapiens
-
-
0.000000354
grassystatin B
Homo sapiens
-
-
0.0000429
grassystatin C
Homo sapiens
-
-
0.00024
IIIISCIGDDGHQKKKK
Rattus norvegicus
P16228
-
0.00028
NDDKIIIICCII
Rattus norvegicus
P16228
-
0.00026
NDDKIIIIPTIFGG
Rattus norvegicus
P16228
-
0.00068
NYKDSCIG
Rattus norvegicus
P16228
-
0.000000181
pepstatin A
Homo sapiens
-
-
0.00023
SCGGIIIISCIA
Rattus norvegicus
P16228
-
0.00032
SGLLFRLKGG
Rattus norvegicus
P16228
-
0.00038
YCGGLLPLGGRPPTIFFRLKDYKGDDDK
Rattus norvegicus
P16228
-
SPECIFIC ACTIVITY [µmol/min/mg]
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
2.2
-
hemoglobin as substrate, calculated on the basis of leucine equivalents released
additional information
-
-
additional information
-
-
additional information
-
-
additional information
-
-
additional information
-
-
pH OPTIMUM
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
2 - 3.5
-
hemoglobin as substrate
2.5
-
approximate value, hemoglobin as substrate
2.5 - 3.6
-
hemoglobin as substrate
3
-
approximate value
3.3
-
big ET-3 as substrate
3.5 - 4.4
-
plateau, big ET-1 and 2 as substrates
3.5 - 4.5
-
-
4
-
no cleavage at neutral pH as reported in earlier studies, only cleavage at acidic pH
7.4
-
assay at
additional information
-
two subunits with pI 4.6 and 4.65
additional information
-
no difference with respect to pH-dependence of hydrolysis between recombinant and native enzyme
pH RANGE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
1 - 4
-
83% of maximal activity at pH 1 and 55% of maximal activity at pH 4, hemoglobin as substrate
1.6 - 3.9
-
half-maximal activity at pH 1.6 and 3.9, hemoglobin as substrate
2 - 4
-
90% of maximal activity at pH 2 and half-maximal activity at pH 4, hemoglobin as substrate
2 - 5
-
pH 2.0 and 5.0: approximately 80% of maximal activity
3.5 - 4.8
-
pH 3.5.-4.5: optimum, pH 4.8: about 25% of maximal activity
5 - 7
-
active in the presence of ATP
5.8
-
and above, no activity in the absence of ATP
additional information
-
CatE is normally most acitve at acidic pH, which corresponds to the active endosomal form
additional information
-
lysosomal pH of the wild-type macrophage estimated to 5.3 to 5.5, lysosomal pH of catE-deficient macrophage raises to 6.4 to 6.5
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
37
-
assay at
37
-
assay at
37
-
assay at
40
-
assay at
40
-
assay at
pI VALUE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
SOURCE TISSUE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
SOURCE
-
myeloid dendritic cell
Manually annotated by BRENDA team
-
mature form of CE in the endosomal structure
Manually annotated by BRENDA team
-
of aged rats
Manually annotated by BRENDA team
-
primary hepatocyte cultures
Manually annotated by BRENDA team
-
high relative expression of catE in adenomas and carcinomas relative to normal epithelium
Manually annotated by BRENDA team
-
high relative expression of catE in adenomas and carcinomas relative to normal epithelium
Manually annotated by BRENDA team
-
but not in resting B-lymphocytes
Manually annotated by BRENDA team
-
human M cell
Manually annotated by BRENDA team
-
mature form of CE in the endosomal structure
Manually annotated by BRENDA team
-
derived from mouse bone marrow precursors
Manually annotated by BRENDA team
-
mature form of CE in the endosomal structure
Manually annotated by BRENDA team
-
of aged rats
Manually annotated by BRENDA team
-
of aged rat
Manually annotated by BRENDA team
-
polymorphonuclear leukocytes; rat
Manually annotated by BRENDA team
-
pancreas from normal, chronic pancreatitis and pancreatic ductal adenocarcinoma patients
Manually annotated by BRENDA team
-
cathepsin E is secreted by activated phagocytes
Manually annotated by BRENDA team
-
of human and rat but not in guinea pig, cattle, goat or pig
Manually annotated by BRENDA team
-
proform of CE in the endoplasmic reticulum and the Golgi complex
Manually annotated by BRENDA team
-
proform of CE in the endoplasmic reticulum and the Golgi complex
Manually annotated by BRENDA team
-
increased catE levels in the urine of APC(Min/+) mice
Manually annotated by BRENDA team
additional information
-
tissue distribution
Manually annotated by BRENDA team
additional information
-
cells of the immune system
Manually annotated by BRENDA team
LOCALIZATION
ORGANISM
UNIPROT
COMMENTARY
GeneOntology No.
LITERATURE
SOURCE
-
recombinant enzyme
Manually annotated by BRENDA team
-
in different cell types such as gastric epithelial cells, Langerhans cells, interdigitating reticulum cell and human M cells
Manually annotated by BRENDA team
-
CatE is normally most acitve at acidic pH, which corresponds to the active endosomal form
Manually annotated by BRENDA team
-
in antigen-presenting cells such as microglia, dendritic cells and macrophagess CatE is mainly present in the endosomal compartments
Manually annotated by BRENDA team
-
cathepsin E is localized in endosomal structures of antigen-presenting cells
Manually annotated by BRENDA team
-
in different cell types such as gastric epithelial cells, Langerhans cells, interdigitating reticulum cell and human M cells
-
Manually annotated by BRENDA team
-
proform of CE
-
Manually annotated by BRENDA team
-
recombinant enzyme in Escherichia coli
Manually annotated by BRENDA team
-
non-lysosomal proteinase
Manually annotated by BRENDA team
-
non-lysosomal proteinase
Manually annotated by BRENDA team
-
Cat E is partially present in lysosomes
Manually annotated by BRENDA team
-
cathepsin E is located in mast-cell secretory granules in complex with heparin proteoglycans, and has a role in processing of procarboxypeptidase A into active protease
Manually annotated by BRENDA team
-
in latent form; on cytoplasmic face of the membrane
Manually annotated by BRENDA team
-
converted to active enzyme in membrane associated form; in latent form; on cytoplasmic face of the membrane
Manually annotated by BRENDA team
-
in erythrocytes, gastric cells, renal proximal tubule cells and osteoclasts
Manually annotated by BRENDA team
-
activation by solubilization from membrane
-
Manually annotated by BRENDA team
-
recombinant enzyme
Manually annotated by BRENDA team
additional information
-
subcellular localization
-
Manually annotated by BRENDA team
additional information
-
immunocytochemical localization of recombinant enzyme in transfected cells
-
Manually annotated by BRENDA team
PDB
SCOP
CATH
ORGANISM
UNIPROT
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
42000
-
mature cathepsin E, SDS-PAGE
696014
46000
-
procathepsin E, SDS-PAGE
696014
76000
-
human, SDS-PAGE, non-reducing conditions
30788
76000
-
human, recombinant enzyme, SDS-PAGE, non-reducing conditions
30796
76000
-
guinea pig, SDS-PAGE, non-reducing conditions
30798
76000
-
human, SDS-PAGE, non-reducing conditions
30800
80000
-
guinea pig, procathepsin E, gel filtration, SDS-PAGE, non-reducing conditions
30789
80000
-
human, procathepsin E, SDS-PAGE, non-reducing conditions
30800
82000
-
human, SDS-PAGE, non-reducing conditions
30793, 30795
82000
-
guinea pig, procathepsin E, SDS-PAGE, non-reducing conditions
30798
82000
-
human, SDS-PAGE, non-reducing conditions
30801
82000
-
gel filtration
651042
84000
-
human, recombinant enzyme, SDS-PAGE, non-reducing conditions
30799
85000
-
human
30804
88000
-
Rana catesbeiana, gel filtration
30797
90000
-
human; procathepsin E, SDS-PAGE, non-reducing conditions
30793
90000
-
procathepsin E, SDS-PAGE, non-reducing conditions; Rana catesbeiana
30797
92000
-
dimer due to dimeric linkage between two monomers, non-denaturing PAGE
670765
98000
-
rat, dimer CE-II, gel filtration
30779
additional information
-
amino acid composition; compared to cathepsin D
30777
additional information
-
amino acid sequence
30782
additional information
-
amino acid sequence
30785
additional information
-
amino acid sequence
30786, 30788
additional information
-
amino acid composition; procathepsin E of human or guinea pig, frog pepsinogen or procathepsin D of rat and human
30797
additional information
-
amino acid composition and sequence of procathepsin E from rabbit, guinea pig and human
30798
additional information
-
amino acid sequence
30803
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
?
-
x * 46343, mass spectral analysis
?
x * 41502, calculated
dimer
-
2-dimensional PAGE, electrofocusing in ampholine gradients followed by SDS-PAGE
dimer
-
2 * 41000, SDS-PAGE, reducing conditions
dimer
-
2 * 43000, SDS-PAGE, reducing conditions; 2 * 51000, monomer CE-I, gel filtration, treated with 2-mercaptoethanol
dimer
-
2 * 42000, about, SDS-PAGE, reducing conditions
dimer
-
2 * 38000, SDS-PAGE, reducing conditions
dimer
-
2 * 39000, SDS-PAGE, reducing conditions; 2 * 40086, procathepsin E, deduced from nucleotide sequence; procathepsin E, SDS-PAGE, reducing conditions
dimer
-
SDS-PAGE, reducing conditions
dimer
-
recombinant enzyme, SDS-PAGE, reducing conditions
dimer
-
2 * 45000, procathepsin E, SDS-PAGE, reducing conditions; SDS-PAGE, reducing conditions
dimer
-
2 * 39000, SDS-PAGE, reducing conditions; procathepsin E, SDS-PAGE, reducing conditions; SDS-PAGE, reducing conditions
dimer
-
-
dimer
-
2 * 42000, recombinant enzyme, SDS-PAGE, reducing conditions
dimer
-
2 * 38000, SDS-PAGE, reducing conditions; 2 * 40000, procathepsin E, SDS-PAGE, reducing conditions
dimer
-
SDS-PAGE, reducing conditions
dimer
-
2 * 41000, SDS-PAGE
dimer
-
86000, 2 * 42000, SDS-PAGE
additional information
-
the native enzyme is a dimer that can yield 2 catalytically active subunit molecules of MW 40000-45000 upon exposition to mild reducing conditions
additional information
-
dimeric form is maintained throughout activation of procathepsin E to cathepsin E; interconversion between dimeric and monomeric form of enzyme and proenzyme is reversible and regulated by low concentrations of reducing agents
additional information
-
native cathepsin E is a dimer consisting of 2 identical catalytically active subunits
POSTTRANSLATIONAL MODIFICATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
glycoprotein
-
4% w/w content of proenzyme
glycoprotein
-
carbohydrates account for 3-4% of total molecular mass
glycoprotein
-
enzymes: N-glycosylated with high-mannose type oligosaccharide chain; human and rat erythrocyte enzyme: endo-beta-N-acetylglucosaminidase H-resistant complex or hybrid-type oligosaccharide chain; rat spleen enzyme
glycoprotein
-
enzymes: N-glycosylated with high-mannose type oligosaccharide chain; human recombinant enzyme
glycoprotein
-
-
glycoprotein
-
site of carbohydrate attachment is Asn73
glycoprotein
-
enzymes: N-glycosylated with high-mannose type oligosaccharide chain
glycoprotein
-
-
glycoprotein
-
enzymes: N-glycosylated with high-mannose type oligosaccharide chain
glycoprotein
-
-
glycoprotein
-
N-glycosylation of cathepsin E plays an important role in its processing, maturation and trafficking to the appropriate destination in the cells, but is not necessarily essential for its correct folding
proteolytic modification
-
propeptide of cathepsin E is essential for the correct folding, maturation, and targeting of this protein to its final destination
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
sitting drop vapor diffusion, crystal structure of an activation intermediate of cathepsin E at 2.35 A resolution. The overall structure follows the general fold of aspartic proteases of the A1 family, and the intermediate shares many features with the intermediate 2 on the proposed activation pathway of aspartic proteases like pepsin C and cathepsin D. The pro-sequence is cleaved from the protease and remains stably associated with the mature enzyme by forming the outermost sixth strand of the interdomain beta-sheet
-
pH STABILITY
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
3 - 5.5
-
6 h at 37C, unstable
30800
4
-
2 h at 28C, 60-65% loss of activity
30789
5
-
2 h at 28C, 45% (dimer) and 55% (monomer) loss of activity
30789
5.8
-
75% loss of activity of erythrocyte membrane aspartic proteinase from human erythrocytes, inactivation of slow-moving proteinase from human gastric mucosa and cathepsin E from rat spleen, instable above pH 5.8
30780
6
-
2 h at 28C, 20% loss of activity
30789
6 - 7.4
-
6 h at 37C, rather stable
30800
7
-
2 h at 28C, stable (dimer), 10% loss of activity (monomer)
30789
7.5
-
2 h at 28C, 50% loss of monomeric enzyme activity
30789
8
-
2 h at 28C, 10% (dimer) and 70% (monomer) loss of activity
30789
8.8
-
2 h at 28C, 20% (dimer) and 95% (monomer) loss of activity
30789
additional information
-
resists inactivation upon sequential exposure to acid and alkaline conditions
30782
additional information
-
dimer is stable at weakly alkaline pH while monomer rapidly loses activity above pH 7
30789
additional information
-
monomeric cathepsin E is much less stable in weakly alkaline solution than dimeric form
30798
additional information
-
the pH-stability of the mutant monomeric form in alkaline solution is markedly reduced
30802
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
25
-
and below, stable, t1/2: more than 3 h at pH 9.5
30802
28
-
2 h, enzyme dimer: 60% loss of activity at pH 4, 45% at pH 5, 20% at pH 6 and pH 8.8, stable at pH 7, 10% loss of activity at pH 8, enzyme monomer: 65% loss of activity at pH 4, 55% at pH 5, 20% at pH 6, 10% at pH 7, 50% at pH 7.5, 70% at pH 8 and 95% at pH 8.8
30789
37
-
6 h at pH 6-7.4, rather stable
30789
37
-
t1/2: about 16 h at pH 8.5, t1/2: 40 min at pH 9.5, t1/2: 3 min at pH 10.5
30802
45
-
t1/2: 40 min at pH 8.5
30802
55
-
20 min, inactivation of native enzyme at pH 5.5, only 10% loss of recombinant enzyme activity
30801
55
-
t1/2: 35 min (native enzyme) or 1.7 min (recombinant enzyme) at pH 7.5, t1/2: less than 5 min at pH 8.5
30802
60
-
1 h, 10% loss of activity
30782
additional information
-
no difference in thermostability between recombinant and native enzyme forms
30795
additional information
-
the temperature stability of the mutant monomeric form in alkaline solution is markedly reduced
30802
GENERAL STABILITY
ORGANISM
UNIPROT
LITERATURE
ATP, CTP or GTP stabilizes in the range of pH 5-7.4, not below pH 5, adenosine, sodium triphosphate, ADP, 2,3-diphosphoglycerate do not stabilize
-
Freezing inactivates, 50% glycerol stabilizes
-
STORAGE STABILITY
ORGANISM
UNIPROT
LITERATURE
-20C, procathepsin E, in neutral or weakly alkaline solution with 50% glycerol, several months, cathepsin E is stable under the same conditions provided the pH-value of the storage solution is kept around pH 5.5
-
4C, procathepsin E, stable in saturated solution of ammonium sulfate adjusted to neutral or weakly alkaline pH, cathepsin E is stable under the same conditions provided the pH-value of the storage solution is kept around pH 5.5
-
0C, at pH 8, several months, with some autodigestion
-
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
as procathepsin E
-
2 isozymes
-
as procathepsin E with following activation by lowering the pH-value of the solution to 4
-
immunoaffinity chromatography
-
monomeric form
-
recombinant
-
recombinant from heterologous Chinese hamster ovary cells (3 forms: cytosolic s-CE and vacuolar v-CE-1 and 2)
-
recombinant from Pichia pastoris
-
DEAE-Sephacel chromatography and immunodepletion
-
affinity chromatography
-
2 catalytically active forms CE-I and CE-II; gastric enzyme
-
as procathepsin E from spleen
-
wild-type and T284S and D98E mutant proteins
-
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
guinea pig; human; rabbit
-
guinea pig; procathepsin E
-
expressed in Chinese hamster ovary cells
-
expressed in Chinese hamster ovary cells; human; procathepsin E
-
expressed in Escherichia coli BL21(DE3)pLysS; human
-
expressed in Pichia pastoris cells; human
-
guinea pig; human; rabbit
-
HEK-293 cells are transfected with the full length human cathepsin E gene cloned into pcDNA3.1V5His
-
human (gastric adenocarcinoma)
-
human pro-cathepsin E is expressed in Escherichia coli in the form of inclusion bodies. The protein is dissolved in 8 M guanidinium chloride and refolded by dilution/dialysis. The main side products in the refolding reaction were soluble, high molecular mass protein complexes linked most likely due to formation of wrong intra- and intermolecular disulfide bonds. Pro-cathepsin E auto-activates at pH 3.5. The major part of the high molecular mass complexes is easily removed during the auto-activation process as these protein components precipitate during the pH shifts
-
stable expression in human prostate carcinoma cell line ALVA101, product is named ALVA101/hCE
-
expression in HEK293T cells of wild-type and mutant form
-
guinea pig; human; rabbit
-
construction of two fusion proteins using chimeric DNAs encoding the cathepsin E propeptide fused to the mature cathepsin D tagged with HA at the COOH terminus and encoding the cathepsin D propeptide fused to the mature cathepsin E
-
guinea pig; human; rabbit
-
heterologously expressed in human embryonic kidney 293T cells
-
mutants with changed active-site residues and lacking propeptides and N-glycosylation, expressed in human embryonic kidney 293T cells
-
EXPRESSION
ORGANISM
UNIPROT
LITERATURE
cathepsin E mRNA is highly upregulated in a human pancreatic ductal adenocarcinoma and pancreatic intraepithelial neoplasia lesions as well as in genetically engineered mouse models of pancreatic cancer
-
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
D98A/D283A
-
expression in HEK293T cells
D283A
-
site-directed mutagenesis
D283E
-
site-directed mutagenesis
D98A
-
site-directed mutagenesis
D98A/D283A
-
double mutant, site-directed mutagenesis
D98A/D283A
-
mutant enzyme has no catalytic activity on either protein or synthetic substrates. In contrast with wild-type cathepsin E, the mutant enzyme is neither processed nor matured even after a 24-h chase period, but stably remains as a 46000 Da precursor
D98E
-
site-directed mutagenesis
N324D
-
N-glycosylation-deficient mutant is neither processed into a mature form nor transported to the endosomal compartement, but is stable retained in the endoplasmic reticulum without degradation
N92Q
-
N-glycosylation-deficient mutant is neither processed into a mature form nor transported to the endosomal compartement, but is stable retained in the endoplasmic reticulum without degradation
N92Q/N374D
-
N-glycosylation-deficient mutant is neither processed into a mature form nor transported to the endosomal compartement, but is stable retained in the endoplasmic reticulum without degradation
T284S
-
site-directed mutagenesis
D98E/D283E
-
double mutant, site-directed mutagenesis
additional information
-
construction of two fusion proteins using chimeric DNAs encoding the cathepsin E propeptide fused to the mature cathepsin D tagged with HA at the COOH terminus and encoding the cathepsin D propeptide fused to the mature cathepsin E
APPLICATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
medicine
-
combination of cathepsin E and doxorubicin is sufficient to overcome resistance to tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis in chemoresistant prostate cancer PPC-1 cells
medicine
-
cathepsin E is a specific marker of dysplasia in APC(Min/+) mouse intestine. Potential utility for catE as a marker for the inception and progression of intestinal cancers
medicine
-
antitumor activity of cathepsin E in human prostate carcinoma tumor cell lines
medicine
-
pancreas-bearing pancreatic intraepithelial neoplasia lesions and pancreatic tumours show an elevated expression of cathepsin E, allowing selective in-vivo detection of human pancreatic ductal adenocarcinoma xenografts and imaging of pancreas with pancreatic intraepithelial neoplasia lesions and pancreatic tumours in genetically engineered mouse models of pancreatic cancer
additional information
-
CatE is essential for processing of ovalbumin by murine B-cells, Cat E could play a major role in antigen processing, involvement of CatE in the MHC class II pathway
molecular biology
-
CatE is a potential cancer biomarker
additional information
-
CatE is essential for processing of ovalbumin by murine B-cells, Cat E could play a major role in antigen processing, involvement of CatE in the MHC class II pathway