Information on EC 3.1.27.2 - Bacillus subtilis ribonuclease

Word Map on EC 3.1.27.2
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)

The enzyme appears in viruses and cellular organisms

EC NUMBER
COMMENTARY hide
3.1.27.2
-
RECOMMENDED NAME
GeneOntology No.
Bacillus subtilis ribonuclease
REACTION
REACTION DIAGRAM
COMMENTARY hide
ORGANISM
UNIPROT
LITERATURE
endonucleolytic cleavage to 2',3'-cyclic nucleotides
show the reaction diagram
REACTION TYPE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
hydrolysis of phosphoric ester
-
-
-
-
ORGANISM
COMMENTARY hide
LITERATURE
UNIPROT
SEQUENCE DB
SOURCE
strain B-916
-
-
Manually annotated by BRENDA team
gene rnjA encoding RNase J1, anf gene rnjB encoding RNase J2
-
-
Manually annotated by BRENDA team
gene rny encoding RNase Y under control of the inducible Pspac promoter
-
-
Manually annotated by BRENDA team
similar enzyme
-
-
Manually annotated by BRENDA team
-
SwissProt
Manually annotated by BRENDA team
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
evolution
malfunction
metabolism
-
Bacillus subtilis endonucleases Bs-RNase III, RNase M5, RNase P, RNase Z, EndoA, and Mini-III are not involved in rpsO mRNA decay, the upstream products are degraded by polynucleotide phosphorylase (PNPase), and the downstream products were degraded by the 5' exonuclease activity of RNase J1
physiological function
additional information
SUBSTRATE
PRODUCT                       
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
20 nt RNA + H2O
?
show the reaction diagram
-
32pUGGUGGUGGAUCCCGGGAUC, exoribonuclease activity
-
-
?
30 nt RNA + H2O
?
show the reaction diagram
-
RT-FeDEx assay of RNase J1, J2 and the RNase J1/J2 complex, 30 nt RNA labelled with a carboxyfluorescein group at its 3'-end and hybridized to a 17 nt DNA bearing a 5'-quenching group carboxymethylrhodamine, exoribonuclease activity
-
-
?
350 nt RNA + H2O
?
show the reaction diagram
-
5'-triphosphate-labelled 350 nt fragment corresponding to the Bacillus subtilis thrS leader mRNA and 46 nts of coding sequence, and a 570 nt fragment corresponding to the hbs P3 transcript, endonucleolytic activity
-
-
?
DELTAermC mRNA + H2O
?
show the reaction diagram
-
DELTAermC mRNA decay is RNase J1 dependent. Decay-initiating endonuclease cleavage can occur at several sites near the 3' end. Preferred RNase J1 target sites are located in the downstream half of DELTAermC mRNA, located upstream of eSL1 (ermC stem-loop 1), between eSL1 and eSL2, and between eSL2 and the 3' transcription terminator. The putative endonuclease cleavages in the body of the message are not dependent on ribosome flow. Even in the absence of these sites, stability is further increased in a strain with reduced RNase J1, suggesting alternate pathways for decay that can include exonucleolytic decay from the 5' end
-
-
?
NotI_34 RNA + H2O
?
show the reaction diagram
NotI_34:rpsO-TT RNA + H2O
?
show the reaction diagram
-
-
-
-
?
RNA + H2O
2',3'-cyclic nucleotides
show the reaction diagram
rpsO mRNA + H2O
?
show the reaction diagram
trp leader RNA + H2O
?
show the reaction diagram
trp:rpsO-TT RNA + H2O
?
show the reaction diagram
-
endonucleolytic cleavage by ribonuclease RNase J1
-
-
?
additional information
?
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate) hide
LITERATURE
(Substrate)
COMMENTARY
(Product) hide
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
RNA + H2O
2',3'-cyclic nucleotides
show the reaction diagram
rpsO mRNA + H2O
?
show the reaction diagram
-
aspects of mRNA decay initiation in Bacillus subtilis. Endonuclease cleavage in the body of the message, rather than degradation from the native 3' end, is the rate-determining step for mRNA decay
-
-
?
trp leader RNA + H2O
?
show the reaction diagram
additional information
?
-
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
Ca2+
-
slight
Co2+
-
slight
Mg2+
-
required
Ni2+
-
slight
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
calf thymus native DNA
-
slight
-
diazo-1H-tetrazol
-
-
EDTA
-
only intracellular RNase
GDP
-
less effective than ATP, competitive inhibitor, inhibition influenced by pH, enhanced inhibition at pH 7.0
GTP
-
less effective than ATP, competitive inhibitor, inhibition influenced by pH, enhanced inhibition at pH 7.0
UDP
-
slight at pH 7.0
additional information
-
the 5'-to-3' exoribonuclease activity of the enzyme is active on 5'-monophosphorylated or 5'-hydroxylated RNA, but is essentially completely inhibited by the triphosphorylated 5' ends of primary transcripts
-
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
0.00022 - 0.00596
30 nt RNA
-
0.0000217
NotI_34 RNA
-
pH 8.0, 30C
-
0.0000182
NotI_34:rpsO-TT RNA
-
pH 8.0, 30C
-
0.0000095
trp leader RNA
-
pH 8.0, 30C
-
0.0000079
trp:rpsO-TT RNA
-
pH 8.0, 30C
-
additional information
additional information
-
apparent dissociation constants (Kapp) for TRAP binding to various trp leader RNA derivatives
-
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
IMAGE
0.005 - 0.58
30 nt RNA
-
0.024 - 0.37
pre-tRNAAsp
-
pH OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
5.5 - 5.7
-
-
8
-
assay at
8.8
-
in vitro processing assay
pH RANGE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
30
-
assay at
pI VALUE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
6.2
-
RNase J1, calculated from sequence
9
-
RNase J2, calculated from sequence
SOURCE TISSUE
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
SOURCE
additional information
LOCALIZATION
ORGANISM
UNIPROT
COMMENTARY hide
GeneOntology No.
LITERATURE
SOURCE
-
lysosome; not extracellular Rnase
Manually annotated by BRENDA team
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
25000
-
allosteric mechanism; gel filtration
41900
-
determined by SDS-PAGE
300000
-
RNase J1 in complex with RNase J2, gel filtration
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
heterotetramer
-
RNase J1 in complex with RNase J2, gel filtration
additional information
POSTTRANSLATIONAL MODIFICATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
ribonucleoprotein
-
RNase P protein is the protein subunit in the RNase P holoenzyme and is an intrinsically disordered protein
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
enzyme with bound 4 nt RNA with sequence CUGG or a 16 nt RNA, using catalytically inactive mutant H77A and a 2'-O-methylated, 3'-fluorescein-labeled RNAs, X-ray diffraction crystal structure determination and analysis at 2.5-3.1 A resolution, molecular replacement
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
100
-
completely inactivated
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
almost homogeneous
-
by CM-Sepharose ion-exchange chromatography and affinity chromatography
-
partial 17fold of the intracellular enzyme
-
partial 30fold
-
recombinant wild-type and mutant protein P proteins from Escherichia coli strain BL21 (DE3) pLysS
-
RNases J1, J2 and the RNase J1/J2 complex purified on cobalt column and by gel filtration
-
the protein is purified from Bacillus subtilis cultures, using a DEAE-Sepharose Fast Flow column, a Phenyl Sepharose 6 Fast Flow column and a hydroxyapatite column
-
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
chromosomal DNA from the RNase J1 conditional mutant strain used to transform Bacillus subtilis host BG1 to erythromycin resistance. The RNase J1 conditional strain also contains plasmid pMAP65, which carries extra copies of the lacI gene. Preparation and transformation of Bacillus subtilis competent cell cultures. RNase J1 transcription under control of an IPTG-inducible promoter in the RNase J1 conditional mutant strain
-
cloning of rnjB gene, encoding RNase J2, and/or rnjA gene expressing RNase J1 in the pET28a vector together or alone. Overexpression of C-terminal His-tagged RNase J1 and/or C-terminal His-tagged RNase J2 simultaneously or alone in Escherichia coli strain BL21 CodonPlus
-
gene rnjA, DNA and amino acid sequence determination and analysis, sequence comparison to Bacillus subtilis enzyme, phylogenetic analysis; gene rnjB, DNA and amino acid sequence determination and analysis, sequence comparison to Bacillus subtilis enzyme, phylogenetic analysis
gene rnjB is transcribed constitutively from a sigma A promoter. Gene rnjA is transcribed as a bicistronic transcript from a single promoter, optimal expression of RNase J1 from gene rnjA requires cotranscription and cotranslation with the upstream ykzG gene, sequence and regulatory elements upstream of the rnjA open reading frame, overview. In the absence of coupled translation, RNase J1 expression is decreased more than 5fold, transcription of the ykzG operon initiates at a sigma A promoter with a noncanonical35 box that is required for optimal transcription. In Bacillus subtilis strain SSB356, the rnjA gene is under the control of the xylose-inducible Pxyl promoter
-
gene rny, encoding RNase Y under control of the inducible Pspac promoter, DNA and amino acid sequence determination and analysis
-
into the pET28b vector for expression in Escherichia coli BL21DE3pLysS cells
-
overexpression of wild-type and mutant protein P proteins in Escherichia coli strain BL21 (DE3) pLysS
-
the wild-type ykqC gene is cloned into the pET28 vector for expression in Escherichia coli BL21 CodonPlus cells, the plasmids pMUTIN-4M, pBS-Spc and pSWEET are used for the construction of different Bacillus subtilis strains
-
EXPRESSION
ORGANISM
UNIPROT
LITERATURE
biosynthesis of enzyme RNase J1 is autocontrolled within a small range (1.4fold) and also slightly stimulated (1.4fold) in the absence of enzyme RNase J2
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
D15C
-
single-cysteine P protein mutant for cross-linking assay
D42C
-
single-cysteine P protein mutant for cross-linking assay
E40C
-
single-cysteine P protein mutant for cross-linking assay
F107W
-
site-directed mutagenesis, pH titration experiments and comparison to the wild-type enzyme
H105K
-
site-directed mutagenesis, pH titration experiments and comparison to the wild-type enzyme
H22K
-
site-directed mutagenesis, pH titration experiments and comparison to the wild-type enzyme
H3C
-
single-cysteine P protein mutant for cross-linking assay
H3K
-
site-directed mutagenesis, pH titration experiments and comparison to the wild-type enzyme
H76A
-
site-directed mutagenesis, a RNase J1 mutant
K64C
-
single-cysteine P protein mutant for cross-linking assay
N61C
-
single-cysteine P protein mutant for cross-linking assay
Q38C
-
single-cysteine P protein mutant for cross-linking assay
R45C
-
single-cysteine P protein mutant for cross-linking assay
R60C
-
single-cysteine P protein mutant for cross-linking assay
R62C
-
single-cysteine P protein mutant for cross-linking assay
R65C
-
single-cysteine P protein mutant for cross-linking assay
R68C
-
single-cysteine P protein mutant for cross-linking assay
R7C
-
single-cysteine P protein mutant for cross-linking assay
V46C
-
single-cysteine P protein mutant for cross-linking assay
H76A
-
site-directed mutagenesis, a RNase J1 mutant
-
H77A
catalytically inactive mutant
additional information
Renatured/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
denaturing the enzyme with 6 M guanidine-HCl
-
APPLICATION
ORGANISM
UNIPROT
COMMENTARY hide
LITERATURE
biotechnology