Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
5'-O-(3-Thio)adenosine triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
5'-O-(3-Thio)adenosine monophosphate + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
adenosine 5'-[alpha-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
adenosine 5'-[beta,gamma-imido]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
adenosine 5'-[gamma-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
ADP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + phosphate + (deoxyribonucleotide)n+m
AMP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
ATP + (2E,6E)-farnesyl diphosphate
adenosine 5'-((2E,6E)-farnesyl triphosphate) + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + (2E,6E)-farnesyl triphosphate
adenosine 5'-((2E,6E)-farnesyl tetraphosphate) + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + (deoxyribonucleotide)20 + (deoxyribonucleotide)20
AMP + diphosphate + (deoxyribonucleotide)40
-
sealing of a single nick in a 20mer DNA duplex, ADL is specific for nicked DNA and is not able to catalyze blunt end joining
-
?
ATP + (deoxyribonucleotide)30 + (deoxyribonucleotide)40
AMP + diphosphate + (deoxyribonucleotide)70
ligTK displays little but significant ativity with NAD+
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
ATP + (dT)20
AMP + diphosphate + ?
-
-
-
-
?
ATP + (nicked double-stranded DNA)n + (nicked double-stranded DNA)m
AMP + diphosphate + (nicked double-stranded DNA)n+m
-
-
-
?
ATP + (single-stranded DNA splinted by RNA)m + (single-stranded DNA splinted by RNA)n
AMP + diphosphate + (single-stranded DNA splinted by RNA)m+n
-
-
-
-
?
ATP + ADP
P1-(5'-adenosyl),P3-(5'-adenosyl)triphosphate + diphosphate
-
-
-
?
ATP + CDP
P1-(5'-adenosyl),P3-(5'-cytidyl)triphosphate + diphosphate
-
-
-
?
ATP + clodronate
adenosine 5'-triphosphate derivative of clodronate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + CTP
P1-(5'-adenosyl),P4-(5'-cytidyl)tetraphosphate + diphosphate
-
-
-
?
ATP + dCTP
P1-(5'-adenosyl),P4-[5'-(2'-deoxycytidyl)]tetraphosphate + diphosphate
-
-
-
?
ATP + dGTP
P1-(5'-adenosyl),P4-[5'-(2'-deoxyguanosyl)]tetraphosphate + diphosphate
-
-
-
?
ATP + dimethylallyl diphosphate
adenosine 5'-dimethylallyltriphosphate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + DNA
AMP + diphosphate + ?
ATP + DNA substrate S4
AMP + diphosphate + ?
ATP + dTTP
P1-(5'-adenosyl),P4-(5'-thymidyl)tetraphosphate + diphosphate
-
-
-
?
ATP + etidronate
adenosine 5'-triphosphate derivative of etidronate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + GDP
P1-(5'-adenosyl),P3-(5'-guanosyl)triphosphate + diphosphate
-
-
-
?
ATP + geranyl diphosphate
adenosine 5'-geranyl triphosphate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + geranyl triphosphate
adenosine 5'-geranyl tetraphosphate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + GTP
P1-(5'-adenosyl),P4-(5'-guanosyl)tetraphosphate + diphosphate
-
-
-
?
ATP + isopentenyl diphosphate
adenosine 5'-isopentenyl triphosphate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + isopentenyl triphosphate
adenosine 5'-isopentenyl tetraphosphate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + methylenebisphosphonate
adenosine 5'-triphosphate derivative of methylenebisphosphonate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + nicked DNA
AMP + diphosphate + ?
ATP + tripolyphosphate
adenosine 5'-triphosphate derivative of tripolyphosphate + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + UTP
P1-(5'-adenosyl),P4-(5'-uridinyl)tetraphosphate + diphosphate
-
-
-
?
ATP + XDP
P1-(5'-adenosyl),P4-(5'-xanthosyl)tetraphosphate + diphosphate
-
-
-
?
ATP + XTP
P1-(5'-adenosyl),P4-(5'-xanthosyl)tetraphosphate + diphosphate
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
ATPalphaS + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase II can use ATPalphaS much more efficiently than DNA ligase I
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
additional information
?
-
adenosine 5'-[alpha-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
Tequatrovirus T4
-
the reaction rate is slower relative to reactions that use ATP. With adenosine 5'-[alpha-thio]-triphosphateas the cofactor, the ligase displays a significantly higher selectivity for ternary substrates having matched base pairs at the nick site
-
-
?
adenosine 5'-[alpha-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
the reaction rate is slower relative to reactions that use ATP. With ATP-alphaS as the cofactor, the ligase displays a significantly higher selectivity for ternary substrates having matched base pairs at the nick site
-
-
?
adenosine 5'-[beta,gamma-imido]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
Tequatrovirus T4
-
the ATP analogue has a different reactivity in the first reaction to adenylate the probe strand but the overall selectivity does not deviate from those observed when ATP is used
-
-
?
adenosine 5'-[beta,gamma-imido]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
the ATP analogue has a different reactivity in the first reaction to adenylate the probe strand but the overall selectivity does not deviate from those observed when ATP is used
-
-
?
adenosine 5'-[gamma-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
Tequatrovirus T4
-
the ATP analogue has a different reactivity in the first reaction to adenylate the probe strand but the overall selectivity does not deviate from those observed when ATP is used
-
-
?
adenosine 5'-[gamma-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
the ATP analogue has a different reactivity in the first reaction to adenylate the probe strand but the overall selectivity does not deviate from those observed when ATP is used
-
-
?
ADP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + phosphate + (deoxyribonucleotide)n+m
activity with ADP is slightly lower than with ATP
-
-
?
ADP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + phosphate + (deoxyribonucleotide)n+m
activity with ADP is slightly lower than with ATP
-
-
?
AMP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
Tequatrovirus T4
-
the reaction rate is slower relative to reactions that use ATP
-
-
?
AMP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
the reaction rate is slower relative to reactions that use ATP
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase III plays a role in meiotic recombination
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase III may be involved in DNA repair
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase is biologically active to endonucleolytically cleaved pBR322 DNA
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
mutants fail to produce progeny phage when grown on ligase-deficient strains of E. coli
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase III seals DNA strand breaks that arise during the process of meiotic recombination in germ cells and as a consequence of DNA damage in somatic cells
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase III is active in DNA repair and recombination
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase III-beta is expressed only in male meiotic germ cells, suggesting a role for this isoform in meiotic recombination
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase I is the key enzyme for joining Okazaki fragments during lagging-strand DNA synthesis in mammalian cells and also for completion of DNA excision repair processes
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase I is involved in DNA replication
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase II might work at the final step of meiotic recombination reaction
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
DNA ligase I is involved in DNA repair and genetic recombination and is required for replication
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
Tequatrovirus T4
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
Tequatrovirus T4
-
DNA ligase mutations drastically affect DNA synthesis, little effect on genetic recombination and repair of UV damage
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
-
nonessential for viral DNA replication and growth on several types of host cells. DNA ligase I participates in DNA base excision repair as a component of a multiprotein complex
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
DNA ligase of Africxan swine fever virus is the lowest-fidelity DNA ligase ever reported, capable of ligating a 3' C:T mismatched nick (where C and T are the templating and nascent nucleotides, respectively) more efficient than nicks containing Watson-Crick base pairs. The DNA ligase of African swine fever virus adenylates the 3'-amino-containing substrate extremely inefficiently, with reactions typically proceeding to only 5% completion
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
DNA ligase I is able to ligate nicks in oligo(dT)/poly(dA) and oligo(rA)/poly(dT) substrates but not in oligo(dT)/poly(rA) substrates, double-stranded DNA's with cohesive or blunt ends are also good substrates
ability of DNA ligase I to revert the ligation reaction by relaxing the supercoiled DNA
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
inable to join oligo(dT) molecules hybridized to poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
ligation of oligo(dT)/poly(dA) and oligo(dT)/poly(rA) and oligo(rA)/poly(dT)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
ligation of oligo(dT)/poly(dA) and oligo(dT)/poly(rA), unable to ligate oligo(rA)/poly(dT)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
joins 2 DNA sequences on a DNA template but not on a RNA template
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
possible role of the ligase in regulating minicircle replication
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
the kinetoplast-specific DNA ligase is proposed to be involved in the repair of gaps in the newly synthesized minicircles
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
both nick sealing and blunt end ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
ligation activity of DNA ligase IV-XRCC4 complex depends upon substrate length, efficient ligation of a 445 bp substrate, little ligation of a 53 bp substrate
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
ligation of oligo(dT)/poly(dA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
ligation of oligo(dT)/poly(dA) and oligo(dT)/poly(rA), unable to ligate oligo(rA)/poly(dT)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
the concerted reaction of polynucleotide kinase and DNA ligase I can efficiently repair DNA nicks possessing 3'-phosphate and 5'-hydroxyl termini
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
DNA ligase I is involved in several important cellular pathways such as DNA replication, DNA repair and DNA recombination, DNA elongation by polymerase delta is strongly inhibited by DNA ligase I
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
DNA ligase I might be involved in repair of DNA strand breaks prior to the resumption of DNA synthesis
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
DNA ligase IV is involved in DNA-protein kinase-dependent form of non-homologous end joining
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
DNA ligase IV-XRCC4 complex functions in DNA non-homologous-end joining, the main pathwy for double-strand repair in mammalian cells
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
essential enzyme for completing DNA replication and DNA repair by ligating Okazaki fragments and by joining single-strand breaks formed either by DNA-damaging agents or indirectly by DNA repair enzymes, respectively
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
the ability of DNA ligase I to promote the recombinational repair of DNA double-strand breaks is dependent upon its interaction with proliferating cell nuclear antigen. DNA ligase I-deficiency reduces recombinational repair of DNA double-strand breaks
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
DNA ligase I ligates Okazaki fragments during lagging strand DNA replication events
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
synthetic 28-mer oligonucleotide duplex that contains a nick with a 3'-hydroxyl and a 5'-phosphate, more than 95% of the nicked DNA is ligated within 2 s
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
DNA ligase is able to ligate a double stranded synthetic DNA substrate containing a single nick and inefficiently ligates a 1-nucleotide gap but does not ligate a 2 nucleotide gap, it is able to ligate short complementary overhangs but not blunt-ended double-stranded DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
strandjoining on a singly nicked DNA in the presence of a divalent cation and ATP
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
protein Rad54 and DNA ligase IV cooperate to support cellular proliferation, repair spontaneous double-strand breaks, and prevent chromosome and single chromatid aberrations
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
the polymerase domain has DNA-dependent RNA primase activity, catalysing the synthesis of unprimed oligoribonucleotides on single-stranded DNA templates. The polymerase domain can also extend DNA in a template-dependent manner. The ligase domain catalyses the sealing of nicked double-stranded DNA designed to mimic a double-strand break, consistent with the role of Mt-Lig in non-homologous end-joining. The nuclease domain did not function independently as a 3'-5' exonuclease. Both the polymerase and ligase domains bind DNA in vitro, the latter with considerably higher affinity
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
template-dependent and template-independent polymerase functions. LigD directs an imprecise non-homologous end-joining pathway for repairing blunt double-strand breaks. Another ATP-dependent DNA ligase (LigC) provides backup mechanism for LigD-independent error-prone repair of blunt-end double-strand breaks
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
template-dependent and template-independent polymerase functions
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
catalyzes end-healing and end-sealing steps during nonhomologous end joining
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
intrinsic polymerase function resident within an autonomous C-terminal polymerase domain, LigD-(533840), that flanks an autonomous DNA ligase domain, LigD-(188527)
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
probably involved in non-homologous end joining repair mechanism
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
Tequatrovirus T4
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
Tequatrovirus T4
-
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
Tequatrovirus T4
-
nick-ligation and blunt-end or sticky-end ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
Tequatrovirus T4
-
T4 DNA ligase is capable of joining 7-12mer DNA oligonucleotides containing in some cases up to 7 base pair mismatches
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
Tequatrovirus T4
-
in the first step of catalysis, DNA ligase binds ATP, forming a high-energy covalent enzyme-nucleotide complex. Nucleophilic attack on the alpha-phosphorus of ATP results in cleavage of the triphosphate moiety, formation of the enzyme-AMP epsilon-amino lysyl phosphoramidate, and release of the diphosphate
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
Tequatrovirus T4
-
T4 DNA ligase catalyzes the formation of phosphodiester bonds between neighboring 3'-hydroxyl and 5'-phosphate ends in doublestranded DNA
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
proper base pairing at the 3' side of the nick is necessary for efficient ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
LigTh1519 is capable of ligating the cohesive ends and single-strand breaks in double-stranded DNA with ATP as cofactor
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
-
ligates sticky end substrates efficiently but requires 10% polyethylene glycol 8000 for blunt end ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
the enzyme is inactive when ATP was substituted by AMP or NAD+
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
the enzyme is inactive when ATP was substituted by AMP or NAD+
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
Agrobacterium LigD1 is composed of a central ligase domain fused to a C-terminal polymerase-like (POL) domain and an N-terminal 3'-phosphoesterase (PE) module. The LigD1 protein seals DNA nicks, albeit inefficiently. The LigD1 POL domain has no detectable polymerase activity. The PE domain catalyzes metal-dependent phosphodiesterase and phosphomonoesterase reactions at a primer-template with a 3'-terminal diribonucleotide to yield a primertemplate with a monoribonucleotide 3'-OH end. The PE domain also has a 3'-phosphatase activity on an all-DNA primer-template that yields a 3'-OH DNA end
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
Agrobacterium LigD2 is composed of a central ligase domain fused to a C-terminal polymerase-like (POL) domain and an N-terminal 3'-phosphoesterase (PE) module. The LigD1 protein seals DNA nicks, albeit inefficiently. The LigD2 POL domain adds ribonucleotides or deoxyribonucleotides to a DNA primer-template, with rNTPs being the preferred substrates. The PE domain catalyzes metal-dependent phosphodiesterase and phosphomonoesterase reactions at a primer-template with a 3'-terminal diribonucleotide to yield a primer-template with a monoribonucleotide 3'-OH end. The PE domain also has a 3'-phosphatase activity on an all-DNA primer-template that yields a 3'-OH DNA end
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase I joins single strand breaks in double stranded DNA, is active on oligo(dT) hybridized to poly(dA), and does not catalyze the joining of oligo(dT)*poly(rA). DNA ligase II and III catalyze the joining of oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
inability to ligate oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
converts nicked circular DNA molecules to a covalently closed form
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Cinqassovirus aeh1
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
capable of joining (dT)20*(rA)n and (rA)12-18*(dT)n as well as (dT)20*(dA)n, ligation of blunt-ended DNA in the presence of polyethylene glycol 6000
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
poly(ADP-ribose) polymerase-1 and XRCC1/DNA ligase III are involved in an alternative route for DNA double-strand breaks rejoining
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
joins oligo(rA) annealed to poly(dT) with 250fold lower efficiency than it joins oligo(dT) annealed to poly(dA), ligates blunt-ended DNA fragments in the presence of 15% polyethylene glycol 80000
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase I: performs blunt end ligation of DNA in presence of glycol, can ligate (rA)*poly(dT) hybrid substrate, unable to join oligo(rA)*poly(rU), unable to join oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
overview: activity of DNA ligase on ribo- and deoxyribopolymer substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
reverse reaction: incubation of superhelical closed circular DNA molecules with the enzyme and AMP results in the production of a population of DNA molecules which have lost most of their superhelical density
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase I and II ligate 5'-phosphoryl and 3'-hydroxyl groups in oligo(dT) in the presence of poly(dA). DNA ligase II can join oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
p(dT)7U can be joined when annealed with poly(dA), joining of oligonucleotides containing a single mismatched nucleotide at their 3'-hydroxyl termini, as well as DNA containing short, complementary 5'-protruding ends, and in the presence of glycol 6000, blunt-ended duplex DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
in addition to joining DNA to DNA the enzyme can join the 5'-phosphoryl terminus of RNA to the 3'-hydroxyl terminus of DNA or RNA, when they are annealed with DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
can join a 3'-hydroxyl terminus of DNA to a 5'-hydroxyl terminus of RNA, can join oligo(rA)12*poly(dT), blunt end joining in presence of polyethylene glycol
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
inability to ligate oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase II: can catalyze joining of an oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Enterobacteria phage
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Erwinia phage
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
active on single-stranded RNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
can ligate nicked, cohesive, and blunt-ended DNA fragments
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase joins oligo(dT)*poly(A)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
efficient strand joining on a single nicked DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
ATP-dependent DNA ligase LigA is non-essential for cell viability. Haloferax volcanii also encodes the NAD+-dependent DNA ligase LigN. As with LigA, LigN is also non-essential for cell viability. Simultaneous inactivation of both proteins is lethal, however, indicating that they share an essential function
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase V does not join nicked templates with high efficiency, but can join double-strand breaks with a similar efficiency to DNA ligase I
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
joins single-strand breaks in a double stranded polydeoxynucleotide in an ATP-dependent reaction, can join the hybrid substrates oligo(dT)*poly(rA) and oligo(rA)*poly(dT)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase can reconstitute the transforming activity of Bacillus subtilis DNA inactivated by pancreatic DNAse, unable to use a hybrid substrate where an interrupted polydeoxynucleotide is annealed to a polyribonucleotide
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
the majority of end joining activity in extracts of HeLa cells derives from DNA ligase III. DNA ligase III is a candidate component of backup pathways of nonhomologous end joining. DNA ligase III joins both DNA strands practically simultaneously
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
damaged DNA bases are repaired by base excision repair which can proceed via two pathways: short patch and long patch base excision repair. Inhibition of long patch base excision repair is mediated by the ligation activity of Lig III. Lowering the levels of XRCC1 and Lig III in HeLa cells decreases cellular repair capacity, but substantially increases Pol beta-dependent strand displacement DNA synthesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
detection and characterization of a direct physical interaction between DNA ligase I, proliferating cell nuclear antigen, a DNA sliding clamp, and, more recently, an interaction between DNA ligase I and replication factor C, the sliding clamp loader
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA non-homologous end-joining is a major mechanism for repairing DNA double-stranded breaks in mammalian cells. Key components of the DNA non-homologous end-joining machinery are the Ku heterodimer and the DNA ligase IC/Xrcc4 complex. Ku interacts with DNA ligase IV via its tandem BRCT domain. This interaction is enhanced in the presence of Xrcc4 and dsDNA. Ku nedds to be in its heterodimeric form to bind DNA ligase IV. Altough the interaction between Ku and DNA ligase IV/Xrcc4 occurs in the absence of DNA-PKc, the presence of the catalytic subunit of DNA-PK kinase enhances complex formation
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
interaction between DNA ligase III and DNA polymerase gamma plays an essential role in mitochondrial DNA stability
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
ligase IV/XRCC4 is the sole DNA ligase involved in the repair of double strand breaks via the non-homologous end joining pathway. Analogous to most other DNA ligases, ligase IV/XRCC4 is fairly intolerant of nicks containing mismatched base pairs
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
ligation of DNA is the ultimate step in DNA repair to restore genome integrity. Ligase I and III accumulate at DNA repair sites. DNA Ligase III accumulates at microirradiated sites before DNA ligase. Recruitment of DNA ligase I to sites of DNA damage depends on its interaction with PCNA
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
mitochondrial DNA ligase IIIalpha is critical for the mitochondrial function, role of DNA ligase IIIbeta in gametogenesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
XRCC4 and DNA ligase IV form a complex that is essential for the repair of all double-strand DNA breaks by the nonhomologous DNA end joining pathway in eukaryotes
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
human XRCC4:DNA ligase IV can ligate two double-strand DNA ends that have fully incompatible short 3' overhang configurations with no potential for base pairing. At DNA ends that share 1-4 annealed base pairs, XRCC4:DNA ligase IV can ligate across gaps of 1 nt
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Lessievirus bcepil02
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
joins restriction enzyme DNA fragments with staggered ends. Catalyzes blunt end ligation of DNA, this reaction is stimulated greatly by macromolecular crowding conditions. DNA ligase I is much more effective in blunt end joining than DNA ligase II and III, but is less efficient than T4 DNA ligase. DNA ligase acts at low efficiency as a topoisomerase, relaxing supercoiled DNA in an AMP-dependent reversal of the last step of the ligation reaction, joins oligo(dT) molecules hydrogen-bonded to poly(dA), is not able to ligate oligo(dT) with a poly(rA) complementary strand, can join oligo(rA) molecules hydrogen-bonded to poly(dT)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
inability to ligate oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase I: seals single-strand breaks in DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
ATP is the best nucleotide cofactor for Methanocaldococcus jannaschii DNA ligase. dATP also exhibits some activation on ligation. All other nucleotide cofactors, including NAD+, NADH, UTP, CTP, GTP, dTTP, dCTP, and dGTP, play no role in ligation by the enzyme
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
ATP is the best nucleotide cofactor for Methanocaldococcus jannaschii DNA ligase. dATP also exhibits some activation on ligation. All other nucleotide cofactors, including NAD+, NADH, UTP, CTP, GTP, dTTP, dCTP, and dGTP, play no role in ligation by the enzyme
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase IV is engaged in extrachromosomal circular major satellite synthesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
ATP-dependent ligase LigB displays vigorous nick sealing activity in presence of NAD+ and ATP
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
ATP-dependent ligase LigC displays weak nick joining activity and generates high levels of DNA adenylate intermediate
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
ATP-dependent ligase LigD displays weak nick joining activity and generates high levels of DNA adenylate intermediate
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Okubovirus SPO1
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Paramecium bursaria chlorella virus
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
PfLigI is able to join RNA-DNA substrates only when the RNA sequence is upstream of the nick. Slight activity with dATP. No activity with NAD+, UTP, CTP and GTP. Slight activity with dATP. No activity with NAD+, UTP, CTP or GTP
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Pleurodeles sp.
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
no DNA ligase activity in presence of ADP, AMP, and NAD+
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
annealing of two short oligonucleotides, a 5'-phosphate-terminated strand 30mer (phosphate-5'-AGGTCGACTCCAGAGGATTGTTGACCGGCC-3') and a 5'-TET labeled 20mer (TET-5'-CGCCAAGCTTGCATTCCTAC-3'), to a 40mer complementary oligonucleotide target (5'-CAATCCTCTGGAGTCGACCTGTAGGAATGCAAGCTTGGCG-3')
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase II can use oligo(dT)*poly(rA) as substrate, DNA ligase I not
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
novel form of enzyme different from DNA ligase I: has a unique binding site, which has an absolute requirement for single-strand breaks, unable to join blunt-ended DNA, even in the presence of polyethylene glycol concentrations which stimulate such joining by DNA ligase I and T4 DNA ligase, the enzyme lacks the AMP-dependent nicking/closing reaction
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
inability to ligate oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
inability to ligate oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
low DNA concentrations favor intramolecular reaction, i.e. recircularization, and higher concentrations favor intermolecular reaction, i.e. oligomerization and formation of recombinant molecules
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
some activity in joining RNA molecules annealed to DNA and even RNA:RNA molecules
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
catalyzes blunt end joining of DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
catalyzes blunt end joining of DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
reverse reaction is catalyzed, the enzyme behaves as an AMP-dependent endonuclease, yielding nicked DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
With 10% polyethylene glycol 6000, both cohesive end ligation and blunt end ligation is increased at high concentrations of salt, 150-200 mM NaCl, or 200-250 mM KCl. With 10% polyethylene glycol 6000, intermolecular and intamolecular ligation occurs at low salt concentrations, 0.100 mM NaCl or 0-150 mM KCl. Only linear oligomers are formed by intermolecular ligation at the high concentrations
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
joins DNA annealed to RNA and, to a slight extent, even RNA annealed to its complementary RNA strand
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
ligates oligo(dT) with a poly(rA) complementary strand
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
ligation of flush-ended DNAs
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
joins the cohesive termini of bacteriophage lambda DNA covalently
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
conversion of nicked circular DNA to closed circular DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
enzyme is most sensitive to lesions on the 3'end of the nick compared to the 5'end and to lesions located in the intact template strand. Substrates containing the 8-oxo-7,8-dihydroguanosine/A mismatch are more readily ligated than those with the 8-oxo-7,8-dihydroguanosine/C mismatch. Ligations of duplexes containing the 8-oxo-7,8-dihydroguanosine/T base pair that could adopt an anti-anti conformation proceeds with high efficiencies. An 8-oxo-7,8-dihydroguanosine/A mismatch-containing duplex behaves like 8-oxo-7,8-dihydroinosine/A. Km-values increase by 90-100-fold for 8-oxo-7,8-dihydroguanosine/C-, 8-oxo-7,8-dihydroinosine/C-, 8-oxo-7,8-dihydroinosine/A-, and 8-oxo-7,8-dihydroadenosine/T-containing duplexes compared to that of a G/C-containing duplex. Substrates containing guanidinohydantoin/A, guanidinohydantoin/G, spiroiminodihydantoin/A, and spiroiminodihydantoin/G base pairs exhibit Km values 20-70fold higher than that of the substrate containing a G/base pair, while the Km value for 8-oxo-7,8-dihydroguanosine/A is 5 times lower than that for G/C
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
both adenylyl transfer and phosphodiester bond formation appear to be effectively irreversible under the reaction conditions tested. The rates of the slowest chemical steps for reaction of both phosphorylated substrate and adenylylated substrate are found to be 10times faster than the steady state turnover rates for each substrate, suggesting that the true rate-limiting step during turnover is release of the ligated product or a post-product release conformational change
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
the donor strans is 42 bp (5'TCCGCGGATCCTGAGGTGAAATGTAAATGAAAAAGCCTGAAC3'), acceptor strand is 38 bp (5'CGTCGAGCAGCGAACCTACTGCGTGGCTTCCGGAGCTA3'), and the complement array stran is 80 bp (5'GTTCAGGCTTTTTCATTTACATTTCACCTCAGGATCCGCGGATAGCTCCGGAAGCCACGCAGTAGGTTCGCTGCTCGACG3')
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
unable to seal strands across a 1 nucleotide or 2 nucleotide gap. Ligase action at a 1 nucleotide gap results in accumulation of high levels of the normally undetectable DNA-adenylate reaction intermediate, no DNA-adenylate is formed at a 2 nucleotide gap
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
repairs nicked duplex DNA substrates of a 5'-phosphate terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging template strand. Rapidly and efficiently joins a 3'OH RNA to 5'-phosphate DNA when the reacting polynucleotides are annealed to a bridging DNA strand. Ligation of 3'-OH DNA to 5'-phosphate RNA is 0.2% of the rate of RNA- to-DNA ligation. Requirement for B-form helical conformation on the 5'-phosphate side of the nick. Weak activity in RNA-to-RNA ligation on a bridging DNA template, incapable of joining two DNAs anneald on an RNA template
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
ligation of strand interruptions in oligo(dT)*poly(dA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
inability to ligate oligo(dT)*poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Vibrio phage
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
Xanthomonas phage
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
catalyzes blunt end ligation of DNA, cannot join an oligo(dT)*poly(rA) hybrid substrate
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
-
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
-
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
-
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
-
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + (deoxyribonucleotide)n-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)m
(deoxyribonucleotide)n+m + AMP + diphosphate
-
-
-
?
ATP + DNA
AMP + diphosphate + ?
-
-
-
-
?
ATP + DNA
AMP + diphosphate + ?
-
-
-
-
?
ATP + DNA
AMP + diphosphate + ?
Tequatrovirus T4
-
-
-
-
?
ATP + DNA substrate S4
AMP + diphosphate + ?
-
-
-
?
ATP + DNA substrate S4
AMP + diphosphate + ?
-
-
-
?
ATP + nicked DNA
AMP + diphosphate + ?
-
-
-
-
?
ATP + nicked DNA
AMP + diphosphate + ?
-
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
-
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
-
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
-
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + [DNA ligase]-L-lysine
[DNA ligase]-N6-(5'-adenylyl)-L-lysine + diphosphate
-
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
-
-
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
strandjoining on a singly nicked DNA in the presence of a divalent cation and dATP, approx. 10% of activity with ATP
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
very low activity
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
-
at 35-50% of the activity relative to ATP
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
-
-
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
-
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
Tequatrovirus T4
-
at 0.5% of the activity relative to ATP
-
-
?
additional information
?
-
-
LIG1 repairs single-strand breaks
-
-
?
additional information
?
-
-
the enzyme also has an intrinsic 5'-2-deoxyribose-5-phosphate lyase activity located at the N-terminal ligase domain that in coordination with the polymerization and ligase activities allows efficient repairing of 2'-deoxyuridine-containing DNA in an in vitro reconstituted base excision repair reaction
-
-
?
additional information
?
-
-
CVLig relaxes negatively supercoiled plasmid DNA in the presence of 10 mM AMP to generate a mixture of partially relaxed topoisomers, fully relaxed circles, and nicked circular products
-
-
?
additional information
?
-
-
abortive adenylylation is suppressed at low ATP concentrations (below 100 mM) and pH higher than 8, leading to increased product yields. The ligation reaction is rapid for a broad range of substrate sequences, but is relatively slower for substrates with a 5'-phosphorylated dC or dG residue on the 3' side of the ligation junction
-
-
?
additional information
?
-
DNAligI performs the three conserved steps of a DNA ligation reaction: adenylation, binding to a 5'-phosphorylated nicked DNA substrate and sealing of the nick. DNAligI is also able to ligate a RNA strand upstream of a nucleic acid nick, but not in the downstream or the template position
-
-
?
additional information
?
-
-
DNAligI performs the three conserved steps of a DNA ligation reaction: adenylation, binding to a 5'-phosphorylated nicked DNA substrate and sealing of the nick. DNAligI is also able to ligate a RNA strand upstream of a nucleic acid nick, but not in the downstream or the template position
-
-
?
additional information
?
-
DNAligI performs the three conserved steps of a DNA ligation reaction: adenylation, binding to a 5'-phosphorylated nicked DNA substrate and sealing of the nick. DNAligI is also able to ligate a RNA strand upstream of a nucleic acid nick, but not in the downstream or the template position
-
-
?
additional information
?
-
-
ATP-diphosphate exchange reaction
-
-
?
additional information
?
-
-
ATP-diphosphate exchange reaction
-
-
?
additional information
?
-
-
ATP-diphosphate exchange reaction
-
-
?
additional information
?
-
the ATP-dependent DNA ligase from bacteriophage T7 is a two-domain ligase: the adenylation or nucleotide-binding domain binds ATP and is connected to an OB-fold domain by a flexible linker. The ATP-binding pocket within the amino-terminal domain of bacteriophage T7 is formed by two antiparallel beta-sheets flanked by R-helices
-
-
?
additional information
?
-
-
deficient caspases activation in apoptosis-resistant cancer cells depends on DNA-ligase IV playing a crucial role in the nonhomologous end joining pathway, DNA damage left unrepaired by DNA-ligase IV may be the initiator for caspases activation by doxorubicin in cancer cells
-
-
?
additional information
?
-
-
dissociation of the ligase IV/XRCC4 complex occurs at an early stage in E4 34k-mediated degradation of ligase IV and indicates a role for E4 34k in dissociation of the ligase IV/XRCCC4 complex
-
-
?
additional information
?
-
-
during adenovirus type 5 infection, ligase IV is targeted for degradation in a process that requires expression of the viral E1B 55k and E4 34k proteins while XRCC4 and XLF protein levels remain unchanged, E1B 55k/E4 34-dependent degradation of ligase IV is accompanied by the unexpected loss of DNA binding by XRCC4
-
-
?
additional information
?
-
-
Werner protein physically interacts with X4L4 which stimulates Werner protein exonuclease but not its helicase activity, human RecQ helicase BLM protein which possesses only helicase activity, does not bind to X4L4, and its helicase activity is not affected by X4L4
-
-
?
additional information
?
-
-
the DNA binding domain of human DNA ligase I interacts with both nicked DNA and the DNA sliding clamps, proliferating cell nuclear antigen and hRad9-hRad1-hHus1
-
-
?
additional information
?
-
for efficient ligation, ligase III-alpha is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein
-
-
?
additional information
?
-
-
LIG1 catalyzes the ligation of single-strand breaks to complete DNA replication and repair. The energy of ATP is used to form a new phosphodiester bond in DNA via a reaction mechanism that involves three distinct chemical steps: enzyme adenylylation, adenylyl transfer to DNA, and nick sealing
-
-
?
additional information
?
-
-
-
-
-
?
additional information
?
-
-
-
-
-
?
additional information
?
-
-
DNA ligase I is induced upon cell proliferation, DNA ligase II, and III not
-
-
?
additional information
?
-
-
the PolDom domain of LigD is required for efficient and accurate DNA repair and increases deletions in re-circularized plasmid DNA when expressed with Ku protein in Escherichia coli. The LigDom domain of LigD can function in Ku-dependent repair
-
-
?
additional information
?
-
-
potential role of the LigD 3'-ribonuclease and 3'-phosphatase activities of DNA ligase D in healing damaged ends via ribonucleotide incorporation at non-homologous end joining junctions
-
-
?
additional information
?
-
-
the enzyme also has an intrinsic 5'-2-deoxyribose-5-phosphate lyase activity located at the N-terminal ligase domain that in coordination with the polymerization and ligase activities allows efficient repairing of 2'-deoxyuridine-containing DNA in an in vitro reconstituted base excision repair reaction
-
-
?
additional information
?
-
in addition to sealing a singly nicked fully matched double-stranded DNA substrate, the enzyme is also able to ligate a cohesive-ended double-stranded break and a single nick with a 1 base pair mismatch at the 3'-OH position of the nick, albeit with reduced efficiency. Ligation of a blunt-end double-stranded break and a 1 nucleotide gapped substrate is also detected when enzyme concentrations and extended incubation times are used; however, no activity is seen with a nonphosphorylated 5'-nicked strand or single-stranded DNA
-
-
?
additional information
?
-
the rate of synthesis of Ap4N is double that of the corresponding Ap3N
-
-
?
additional information
?
-
-
the rate of synthesis of Ap4N is double that of the corresponding Ap3N
-
-
?
additional information
?
-
Tequatrovirus T4
-
ATP-diphosphate exchange reaction
-
-
?
additional information
?
-
Tequatrovirus T4
-
ATP-diphosphate exchange reaction
-
-
?
additional information
?
-
Tequatrovirus T4
-
ATP-diphosphate exchange reaction
-
-
?
additional information
?
-
Tequatrovirus T4
-
T4 DNA can adenylate the 5'-phosphorylated donor DNA substrate with a DNA template, ATP, and an acceptor strand that has a strategically chosen C-T acceptor-template mismatch directly adjacent to the adenylation site, between 0.5 and 10 mM ATP the adenylation yield is high (about 60%), whereas the yield is lower outside of this range
-
-
?
additional information
?
-
Tequatrovirus T4
-
in the first, the ligase reacts with ATP to covalently modify an active site lysine residue with AMP. In the second step, the ligase transfers the AMP moiety to the 5'-phosphate group of the substrate DNA strand. In the third step, the 3'-hydroxyl group of the other strand reacts with the activated strand to give a native phosphodiester linkage with concomitant release of AMP
-
-
?
additional information
?
-
Tequatrovirus T4
-
base-pairing of oxanine and cytosine between the ligation fragment and template influences the ligation performance of the T4 DNA ligase to a lesser degree compared to guanine-cytosine base pairing
-
-
?
additional information
?
-
Tequatrovirus T4
-
successful ligation for G:C and no ligation for G:T is observed when oxanine is employed adjacent to guanine in the ligation junction
-
-
?
additional information
?
-
Tequatrovirus T4
-
T4 ligase has a low specificity for adenylating the 5' strand, the ternary complexes having A:G, G:A and C:C mismatched base pairs are efficient substrates for adenylation even though they yield little ligated product
-
-
?
additional information
?
-
Tequatrovirus T4
-
ligation by T4 DNA ligase is dependent on the formation of a double stranded DNA duplex of at least five base pairs surrounding the site of ligation. However, ligations can be performed effectively with overhangs smaller than five base pairs and oligonucleotides as small as octamers, in the presence of a second, complementary oligonucleotide
-
-
?
additional information
?
-
Tequatrovirus T4
-
T4 DNA ligase is also able to capture RNA strands in which a tethered monodeoxynucleoside has acquired a 5' phosphate. The ligation reaction therefore mimics the partition step of a selection for nucleoside kinase (deoxy)ribozymes
-
-
?
additional information
?
-
-
in the first, the ligase reacts with ATP to covalently modify an active site lysine residue with AMP. In the second step, the ligase transfers the AMP moiety to the 5' phosphate group of the substrate DNA strand. In the third step, the 3' hydroxyl group of the other strand reacts with the activated strand to give a native phosphodiester linkage with concomitant release of AMP
-
-
?