Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
hexamer or heptamer
-
stabilized by Mg2+ and ADP bound to the ATPase region
homooligomer
-
the subunits are formed by five successively connected domains, i.e., N-terminal domain, alpha-helical domain, nucleotide-binding domain, second alpha-helical domain, and proteolytic domain, domain organization, overview
?
x * 90700, calculated and SDS-PAGE
?
-
x * 90000, SDS-PAGE
-
?
x * 83000, recombinant enzyme, SDS-PAGE
?
x * 77000, recombinant His-tagged Lon-like-Ms, SDS-PAGE
?
-
x * 77000, recombinant His-tagged Lon-like-Ms, SDS-PAGE
-
?
-
x * 84269, calculated
-
?
x * 89000, Lon, SDS-PAGE
?
-
x * 88800, calculated
-
dodecamer
-
hexamers of Escherichia coli Lon also interact to form a dodecamer at physiological protein concentrations, the dodecamer shows a prolate structure with the protease chambers at the distal ends and a matrix of N domains forming an equatorial hexamer-hexamer interface, with portals of about 45 A providing access to the enzyme lumen
dodecamer
the larger assembly has decreased ATPase activity and displays substrate-specific alterations in degradation compared to the hexamer. The enzyme dodecamer successfully completes many of the Lon protease's important regulatory functions while modifying substrate choice, perhaps to better manage protein quality control under conditions such as UV, heat, and oxidative stress. Identification of N domain interactions underlying Lon dodecamer formation. The Lon N domains are primarily responsible for dodecamer formation, the Lon dodecamer forms via putative N domain coiled-coil interactions. Analytical ultracentrifugation
heptamer
-
cryoelectron microscopy
heptamer
-
7 * 117000, SDS-PAGE
heptamer
-
cryoelectron microscopy
heptamer
-
cryoelectron microscopy and analytic ultracentrifugation
heptamer
-
electron microscopic image analysis
heptamer
-
ring-shaped protease with seven flexible subunits, ultracentrifugation thus showed lon to be a heptamer, in excellent agreement with the STEM analysis
heptamer
-
maize Lon can form a heptameric ring similar to that of yeast Lon. Enzyme with considerably less stability than other mitochondrial Lon proteases. Properties compared with ATP-dependent proteases from different sources
hexamer
-
crystallography
hexamer
6 * 90000, SDS-PAGE, 6 * 88000, calculated
hexamer
-
gel filtration, sedimentation velocity experiments and cross-linking of intact and truncated species
hexamer
-
6 * 90000, SDS-PAGE, 6 * 88000, calculated
-
hexamer
-
6 * 106000, human, calculated from amino acid sequence
hexamer
-
crystallography
hexamer
-
electron microscopy
hexamer
-
negative stain electron microscopy, crystallography of the proteolytic domain
hexamer
gel filtration and glutaraldehyde crosslinking
hexamer
active enzyme form, modeling of the structure of the human mitochondrial Lon hexamer, overview
hexamer
hLon has a unique three-dimensional structure, in which the proteolytic and ATP-binding domains (AP-domain) form a hexameric chamber, while the N-terminal domain is arranged as a trimer of dimers. These two domains are linked by a narrow trimeric channel composed likely of coiled-coil helices. In the presence of AMP-PNP, the AP-domain has a closedring conformation and its N-terminal entry gate appears closed, but in ADP binding, it switches to a lock-washer conformation and its N-terminal gate opens, which is accompanied by a rearrangement of the N-terminal domain. hLon's N-terminal domains are crucial for the overall structure of the hLon, maintaining a conformation allowing its proper functioning. Domain structure, overview
hexamer
Mg2+-activated LonA forms an open hexameric chamber without nucleotide
hexamer
-
analytical ultracentrifugation
hexamer
-
6 * 105000, SDS-PAGE
hexamer
-
6 * 120000, Saccharomyces cerevisiae, SDS-PAGE
hexamer
-
6 * 106000, human, calculated from amino acid sequence
hexamer
-
6 * 105000, SDS-PAGE
hexamer
-
6 * 120000, Saccharomyces cerevisiae, SDS-PAGE
hexamer
-
6 * 120000, SDS-PAGE
hexamer
6 * 65856, calculated
hexamer
6 * 72000, calculated
hexamer
-
6 * 72000, SDS-PAGE
homohexamer
-
-
homohexamer
Lon assembles into a barrel-shaped homohexamer with the proteolytic active sites sequestered in an internal chamber, largely inaccessible to folded proteins. This architecture serves to prevent degradation of non-substrate proteins. Analysis of hexamer-hexamer interactions, usage of an ellipsoidal electron density map sufficient to model two barrel-shaped hexamers at the distal ends of the dodecamer corresponding to the Lon ATPase and protease modules. The two barrels are bridged by six extended helical structures, which are modeled as six N domain dimers forming end-to-end interactions that mimic two-stranded, antiparallel coiled coils
monomer
-
proteolytic domain in solution
monomer
1 * 87400, calculated. Mixture of monomeric and larger oligomeric species, with increasing amounts of larger oligomers present at larger concentrations
monomer
-
proteolytic domain in solution
multimer
-
SDS-PAGE
multimer
-
x * 87000, calculated from DNA sequence
multimer
-
x * 88000, calculated from nucleotide sequence
multimer
-
x * 94000, SDS-PAGE
oligomer
x * 68200, the subunit consist of ATPase and proteolytic domains
oligomer
x * 87400, calculated. Mixture of monomeric and larger oligomeric species, with increasing amounts of larger oligomers present at larger concentrations
oligomer
-
6-7 * 100000, homo-oligomeric complex, SDS-PAGE
tetramer
-
4 * 87000,
tetramer
-
4 * 87000, homotetramer
additional information
-
the enzyme has two domains: the N-terminal ATPase domain with chaperone-like properties and the C-terminal proteolytic domain specific for the ATP-dependent protease family
additional information
protein consists of an N-terminal domain, a central ATPase domain which includes a sensor- and substrate-discrimination domain, and a C-terminal protease domain
additional information
-
protein consists of an N-terminal domain, a central ATPase domain which includes a sensor- and substrate-discrimination domain, and a C-terminal protease domain
-
additional information
-
electron-microscope analysis, enzyme has a six-membered, ring-shaped structure with a central cavity. Side-on view shows a two-layered structure
additional information
-
isolated proteolytic domain LonP, obtained by limited proteolysis, exhibits both peptidase and proteolytic activity, but cleaves large protein substrates at a significantly lower rate than the full size protease. LonAP fragment, containing both the ATPase and the proteolytic domains, retains almost all of the enzymawtic properties of the full-size protein. both LonP and LonAP predominantly form dimers unlike the native protease Lon functioning as a tetramer
additional information
-
the ATPase fragment isolated after chymotryptic digestion of the protein has no ATPase activity in spite of its ability to bind nucleotides. It is monomeric in solution. The isolated monomeric proteolytic fragment does not display proteolytic activity. The intact ATPase/proteolytic fragment forms dimers and tetramers and exhibits properties of a non-processive protease and show ATPase activity with self-degradation upon ATP hydrolysis
additional information
-
compared with hexamers, enzyme dodecamers are much less active in degrading large substrates but equally active in degrading small substrates
additional information
domain organization of Lon protease, overview
additional information
each Lon monomer contains three functional subregions: the N domain, AAA+ ATPase module, and a protease domain. The ATPase and protease domains are the most well-conserved regions of Lon
additional information
-
each Lon monomer contains three functional subregions: the N domain, AAA+ ATPase module, and a protease domain. The ATPase and protease domains are the most well-conserved regions of Lon
additional information
enzyme Ec-Lon subunit includes an ATPase component and a proteolytic component (AAA+ module and P-domain, respectively), as well as a noncatalytic region formed by the N-terminal (N) domain and an inserted alpha-helical (HI(CC)) domain. This region is unique for AAA+ proteins. The C-terminal part of the HI(CC) domain has an allosteric effect on the efficiency of the functioning of both ATPase and proteolytic sites of the enzyme, while the coiled-coil (CC) fragment of this domain interacts with the protein substrate. The HI(CC) domain is not essential for the formation of the ATPase center of Ec-Lon protease, but still has an effect on the functional efficiency of this center. Detailed analysis and comparisons of primary and secondary structures of the HI(CC) domain in AAA* proteases, overview
additional information
-
enzyme Ec-Lon subunit includes an ATPase component and a proteolytic component (AAA+ module and P-domain, respectively), as well as a noncatalytic region formed by the N-terminal (N) domain and an inserted alpha-helical (HI(CC)) domain. This region is unique for AAA+ proteins. The C-terminal part of the HI(CC) domain has an allosteric effect on the efficiency of the functioning of both ATPase and proteolytic sites of the enzyme, while the coiled-coil (CC) fragment of this domain interacts with the protein substrate. The HI(CC) domain is not essential for the formation of the ATPase center of Ec-Lon protease, but still has an effect on the functional efficiency of this center. Detailed analysis and comparisons of primary and secondary structures of the HI(CC) domain in AAA* proteases, overview
additional information
the Ec-Lon subunit comprises N-terminal non-catalytic region, ATPase module and proteolytic domain (serine-lysine endopeptidase)
additional information
the inserted alpha-helical HI(CC) domain is necessary for the formation of the ATPase center of the Ec-Lon protease and its correct functioning
additional information
-
the inserted alpha-helical HI(CC) domain is necessary for the formation of the ATPase center of the Ec-Lon protease and its correct functioning
additional information
-
enzyme binds GT-rich sequences found in the heavy strand of mitochondrial DNA and also interacts specifically with GU-rich RNA. Nucleotide inhibition and protein substrate stimulation coordinately regulate DNA binding
additional information
-
Lon protease specifically binds single stranded DNAs with a propensity for forming parallel G-quartets. Lon binding to the 24-base oligomer LSPas, AATAATGTGTTAGTTGGGGGGTGA is primarily driven by enthalpy change associated with a significant reduction in heat capacity. The Lon-LSPas complex shows a considerable enhancement in thermal stability. Lon binding to an 8-base G-rich core sequence, TG6T is entropically driven with a relatively negligible change in heat capacity
additional information
-
eukaryotic Lon possesses three domains, an N-terminal domain, an ATPase domain and a proteolytic domain
additional information
model on the quaternary structure of the full-length enzyme protein
additional information
-
model on the quaternary structure of the full-length enzyme protein
additional information
quaternary enzyme structure, modelling, overview
additional information
-
quaternary enzyme structure, modelling, overview
additional information
Mg2+-dependent activation and hexamerization of the Lon AAA+ protease. Role of the protease domains in the oligomerization and activity of LonA, overview
additional information
-
the lon protease of Pyrococcus abyssi is interupted by an intein. The intein splices essentially to completion when over-expressed in Escherichia coli. Blocking the first step of splicing with a Cys1 to Ala mutation or step two of splicing with a Ser+1 to Ala mutation leads to the accumulation of precursor. Substitution of Ser+1 with Thr results in precursor, whereas substitution to Cys results in efficient splicing. Prevention of step three of splicing by mutation of the intein C-terminal Asn333 to Ala results in the accumulation of precursor and branched-ester intermediate
additional information
while proteolytic activity is restricted at the P domain, chaperone activity is mediated by the ATP-binding domain and the N-terminal domain