3.1.26.3: ribonuclease III
This is an abbreviated version!
For detailed information about ribonuclease III, go to the full flat file.
Word Map on EC 3.1.26.3
-
3.1.26.3
-
rnai
-
argonaute
-
drosophila
-
germline
-
rna-induced
-
viruses
-
duplex
-
ovarian
-
microprocessor
-
pri-mirnas
-
single-stranded
-
chromatin
-
elegans
-
helicase
-
tumour
-
neoplasm
-
predisposition
-
thyroid
-
tumorigenesis
-
rna-dependent
-
sequence-specific
-
stem-loop
-
3'utrs
-
cystic
-
hotspot
-
rhabdomyosarcoma
-
heterochromatin
-
dsrna-binding
-
snornas
-
retrotransposons
-
exoribonuclease
-
piwi-interacting
-
gene-silencing
-
endonucleolytic
-
rna-directed
-
virus-derived
-
mirna-mediated
-
multinodular
-
overhang
-
wilms
-
rnai-based
-
goiter
-
hamartoma
-
microrna-mediated
-
let-7a
-
exportin
-
dead-box
-
rna-processing
-
pre-rrnas
-
mirna-based
- 3.1.26.3
- rnai
-
argonaute
- drosophila
-
germline
-
rna-induced
- viruses
- duplex
- ovarian
-
microprocessor
-
pri-mirnas
-
single-stranded
- chromatin
- elegans
- helicase
- tumour
- neoplasm
-
predisposition
- thyroid
- tumorigenesis
-
rna-dependent
-
sequence-specific
-
stem-loop
-
3'utrs
-
cystic
-
hotspot
- rhabdomyosarcoma
- heterochromatin
-
dsrna-binding
- snornas
-
retrotransposons
- exoribonuclease
-
piwi-interacting
-
gene-silencing
-
endonucleolytic
-
rna-directed
-
virus-derived
-
mirna-mediated
-
multinodular
-
overhang
-
wilms
-
rnai-based
- goiter
- hamartoma
-
microrna-mediated
-
let-7a
-
exportin
-
dead-box
-
rna-processing
- pre-rrnas
-
mirna-based
Reaction
Endonucleolytic cleavage to a 5'-phosphomonoester =
Synonyms
Aa-RNase III, AbsB, At1g55140, At3g13740, AtRTL1, AtRTL2, AtRTL3, BB_0705, BCG-RNase III, Bm-RNase III, cgR_1959, class 1 RNase III, DCL1, DCL2, DCL3, DCL4, DCR-1, Dicer, Dicer 1, Dicer-1, Dicer-2, Dicer1, double strand-specific endoRNase, Drosha, dsRNA-specific class 1 RNase III-like endoribonuclease, E. coli RNase III, Ec-RNase III, endoribonuclease III, endoribonucleases III, exodeoxyribonuclease III, HCS protein, Hs-Dicer, Hs-Drosha, KREPB10, KREPB9, Lac-RNase III, mini-III, mitochondrial RNA precursor-processing endonuclease 1, More, mRPN1, nuclease, ribo-, D, p241, Pac1p, RBIV RNase III, ribonuclease D, ribonuclease III, ribonuclease III-like protein, ribonuclease type III, RNase D, RNase G, RNase III, RNase III domain A, RNase III double-stranded RNA endonuclease, RNase III endonuclease, RNase III-like protein, RNase O, RNase3, rnc, RNC1, RNC3, RNC4, rncS, RNT1, Rnt1p, Rnt1p RNase III, Sa-RNase III, Sc-Rnt1p, SmRNase III, Tb09.160.3050, Tb927.8.5700, Tm-RNase III, TNase III
ECTree
3.1.26.3 ribonuclease IIIAdvanced search results
results (
results (Substrates Products
Substrates Products on EC 3.1.26.3 - ribonuclease III
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
top
SUBSTRATE 
PRODUCT
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate)
(Substrate)
LITERATURE
(Substrate)
(Substrate)
COMMENTARY
(Product)
(Product)
LITERATURE
(Product)
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
r=reversible
ir=irreversible
?=not specified
35S pre-rRNA + H2O
mature 35S rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
515 bp dsRNA + H2O
?
-
Dicer-2 substrate is synthetic 515 bp dsRNA
-
-
?
Aa-[16S[micro-hp]RNA] + H2O
?
-
structures of the Aquifex pre-16S and pre-23S rRNA processing stems and corresponding hairpin substrates, overview
-
-
?
hairpin RNA R1.1 + H2O
?
-
RNase III(E38A) cleaves at the primary site and remains bound to the RNA, thereby preventing cleavage at the secondary site
-
-
?
mraZ mRNA + H2O
?
the degradation of mraZ mRNA is performed by RNase III and the 3'-to-5' exoribonuclease, PNPase. The cleavage site for mraZ mRNA by RNase III is in the coding region
-
-
?
mRNA + H2O
mature mRNA
-
specific processing of several hairpin nemis+, i.e. Neisseria miniature insertion sequences, mini transcripts, enzyme/substrate interaction, substrate specificity, overview
-
-
?
poly(I C) + H2O
5'-phosphooligonucleotides
-
-
-
-
?
premicro-RNA + H2O
mature micro-RNA
-
RNase III treatment causes a preferential loss of RNA in the 50- to 100-nt region. After RNase III treatment, the ratio of pre- to mature micro-RNA is reduced for micro-RNAs such as hsa-let-7b and hsa-let-7g, in both conditioned medium and mesenchymal stem cells due to a decrease in premicro-RNA level coupled with a concomitant increase in mature micro-RNA level
-
-
?
R1.1 RNA + H2O
2 fragment of R1.1 RNA
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA derivatives + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, derivative R1.1[CL3B] is not cleaved and its binding to the enzyme leads to uncoupling of substrate recognition and cleavage
-
-
?
RNA precursor + H2O
mature RNA
-
phage lambda RNA, enzyme is involved in translation control
-
-
?
RNA substituted with guanosine 5'-O-(1-thiotriphosphate) + H2O
5'-phosphooligonucleotides containing guanosine 5'-O-(1-thiotriphosphate)
-
cleavage specificity is not altered by modified RNA
-
-
?
synthetic 25S rRNA 3' ETS cleavage site containing RNA + H2O
?
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for processing of dsRNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
responsible for processing and maturation of RNA precursors into functional rRNA, mRNA and other small RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves scRNA, similar to signal recognition particle
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
15 bases in average
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
no activity on DNA-RNA hybrids
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
134334, 134335, 134336, 134337, 134338, 134339, 134340, 134341, 134342, 134343, 134345, 134346, 134348, 134349, 134351, 134352, 134353, 134354, 134357, 134358, 134359, 134360, 134361, 134362, 134364, 134365
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
Dicer is a multidomain ribonuclease that processes double-stranded RNAs (dsRNAs) to 21 nt small interfering RNAs (siRNAs) during RNA interference, and excises microRNAs from precursor hairpins. Dicer contains two domains related to the bacterial dsRNA specific endonuclease, RNase III, which is known to function as a homodimer. Enzyme has only one processing center, containing two RNA cleavage sites and generating products with 2 nt 3' overhangs. It is proposed that Dicer functions through intramolecular dimerization of its two RNase III domains, assisted by the flanking RNA binding domains, PAZ and dsRBD
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
RNase D activity in HIV-1 RT is contamination
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
reverse transcriptase of HIV-1 possesses RNase D activity
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
reverse transcriptase of HIV-1 possesses RNase D activity
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
Dicer is a multidomain ribonuclease that processes double-stranded RNAs (dsRNAs) to 21 nt small interfering RNAs (siRNAs) during RNA interference, and excises microRNAs from precursor hairpins. Dicer contains two domains related to the bacterial dsRNA specific endonuclease, RNase III, which is known to function as a homodimer. Enzyme has only one processing center, containing two RNA cleavage sites and generating products with 2 nt 3' overhangs. It is proposed that Dicer functions through intramolecular dimerization of its two RNase III domains, assisted by the flanking RNA binding domains, PAZ and dsRBD
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
involved in the production of short interfering RNAs (siRNAs) and for the processing of precursor miRNAs (pre-miRNAs) into microRNAs (miRNAs)
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
responsible for the production of short interfering RNAs and microRNAs that induce gene silencing known as RNA interference
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
114 bp in length
products shorter than 21 bp
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
the enzyme is able to process rRNAs and to regulate the levels of polynucleotide phosphorylase
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
processing of precursor dsRNAs into mature microRNAs and small-interfering RNAs
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
in vitro dsRNA cleavage assay with a designed 52-nt stem-loop RNA containing a 24-bp stem capped by a GCAA tetraloop as the substrate
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
bacteriophage T7 RNA
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
the enzymatic activity requires a conserved catalytic domain, while RNA binding requires the double-stranded RNA-binding domain at the C-terminus of the protein. Rnt1p specifically cleaves RNAs that possess short irregular stem-loops containing 1214 base pairs interrupted by internal loops and bulges and capped by conserved AGNN tetraloops. A new carboxy-terminal helix following a canonical ds double-stranded RNA-binding domain structure allows the Rnt1p double-stranded RNA-binding domain to bind to short RNA stem-loops by modulating the conformation of helix a1, a key RNA-recognition element of the double-stranded RNA-binding domain
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
the observed interactions between helix alpha1 in the double-stranded RNA binding domain RNA complex in vitro are required for substrate recognition in the context of the entire protein in vivo. The endonuclease domain of Rnt1p is almost immediately N-terminal to the helix alpha1
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
involved in a variety of cellular functions, including the processing of many non-coding RNAs, mRNA decay, and RNA interference, preferred substrate contains NGNN tetraloops
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
a dsRNA-binding domain recognizes its substrate by interacting with stems capped with conserved AGNN tetraloops, new form of Rnt1p substrates identified lacking the conserved AGNN sequence but instead harboring an AAGU tetraloop was found at the 5' end of snoRNA 48 precursor
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
new form of Rnt1p substrates identified harboring an AAGU tetraloop at the 5' end of snoRNA 48 precursor, reactions performed under low salt (10 mM KCl) and physiological salt (150 mM KCl) conditions, construction of substrate containing a AAAU or UUGU structure instead of AAGU showed similar efficiency under low salt conditions but strongly reduced efficiency under physiological salt conditions, stem structure is found to partially contribute t the substrate binding efficiency
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
enzyme plays multiple roles in the processing of rRNA and mRNA and strongly affects the decay of the sRNA MicA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
cleaves multimeric tRNA precursor at the spacer region, also involved in processing of precursor rRNA, hnRNA and early T7-mRNA. Also cleaves double-stranded DNA and single-stranded RNA
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
dsRNA-specific endonuclease activity enhances the RNA-silencing suppression activity of another protein (p22) encoded by SPCSV. RNase3 and p22 coexpression reduce siRNA accumulation more efficiently than p22 alone in Nicotiana benthamiana leaves expressing a strong silencing inducer (i.e., dsRNA). RNase3 does not cause intracellular silencing suppression or reduce accumulation of siRNA in the absence of p22 or enhance silencing suppression activity of a protein encoded by a heterologous virus
-
-
?
double-stranded RNA + H2O
5'-phosphooligonucleotides
-
responsible for processing of dsRNA
small duplex products of 10-18 base pairs
-
?
double-stranded RNA + H2O
?
-
RNA 5, a 30 base stem-loop RNA of the sequence 5 '-AUAAAGGUCAUUCGCAAGAGUGGCCUUUAU-3', is cleaved by RNase III (D44N) from Aquifex aeolicus. The products of the reaction include a dinucleotide 5'-AU-3' and a 28 base stem-loop RNA with a two-base 3' overhang (RNA 6). Two RNA 6 molecules and a dimeric mutant enzyme D44N molecule form a product complex
-
-
?
double-stranded RNA + H2O
?
2'-hydroxyl groups of nucleotides of the tetraloop or adjacent base pairs are predicted to interact with residues of alpha-helix 1 are important for Rnt1p cleavage in vitro
-
-
?
ds-rRNA + H2O
mature ds-rRNA
-
double-strand RNA specific endonuclease
-
-
?
dsRNA + H2O
?
-
RNase III(E38A) generates discrete-sized products from long dsRNA
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors in to mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing, enzyme is required for the orderly progression of plant development and for the defense of eukaryotic parasitic DNA and viruses
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modification of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
enzyme is involved in the maturation and decay of cellular, phage and plasmid RNAs
-
-
?
dsRNA + H2O
mature RNA
-
enzyme plays a key role in diverse maturation and degradation processes
-
-
?
dsRNA + H2O
mature RNA
-
obligatory step in the maturation and decay of diverse RNAs
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modificatin of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
-
double-strand RNA-specific, the dsRNA-binding domain is important for substrate binding but not for catalytic activity, while the catalytic domain is important for catalytic activity but not for substrate binding
-
-
?
dsRNA + H2O
mature RNA
-
one functional monomer is sufficient for cleavage activity of the dimer
-
-
?
dsRNA + H2O
mature RNA
-
reshaping of fully or partially double-stranded RNA precursors into mature RNAs involved in pre-mRNA splicing, RNA modification, translation, gene silencing, and regulation of developmental timing
-
-
?
dsRNA + H2O
mature RNA
-
cleavage of fully or partially double-stranded RNA precursors into mature structural and catalytic RNAs such as the snRNAs that splice pre-mRNA, rRNAs, and tRNAs that function in translation, swnoRNAs that guide modificatin of rRNAs, and individual mRNAs, whose expression they regulate
staggered breaks with 2 nt, 3'-overhanging ends and 5'-phosphate and 3'-hydroxy termini
-
?
dsRNA + H2O
mature RNA
Paramecium bursaria Chlorella virus-1
-
model substrate
product determination
-
?
dsRNA + H2O
mature RNA
-
double-strand RNA specific endonuclease
-
-
?
dsRNA + H2O
mature RNA
-
diverse model RNA substreates, enzyme cleaves specifically RNA stems capped with the conserved AGNN tetraloop, the dsRNA sequence adjacent to the tetraloop regulates enzyme activity by interfering with substrate binding, sequences surrounding the cleavage site directly influence the cleavage efficiency, a minimum substrate length is required
-
-
?
dsRNA + H2O
mature RNA
-
specific for double-stranded RNA, a dimerization signal within the N-terminal domain is required for efficient cleavage
-
-
?
dsRNA + H2O
mature RNA
-
process double-stranded RNAs consisting of two turns of the RNA helix. Although the enzyme plays a role in ribosomal RNA processing and gene regulation, enzyme is not essential for cell growth but regulates virulence gene expression
-
-
?
dsRNA + H2O
mature RNA
members of tRNase III family, which have been implicated in the processing of pre-rRNA, rRNA, polycistronic mRNAs, and small regulatory RNAs, normally cleave duplex segments of RNAs configured as stem-loop structures and are ubiquitous among prokaryotes, eukaryotes, and archaea
-
-
?
dsRNA + H2O
processed RNA
-
specific for double-stranded RNA
enzyme produces 12-15 base pair duplex products with 5'-phosphate, 3'-hydroxyl termini
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
mRNA phage SP82 is cleaved by Bacillus subtilis
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
mRNA phage SP82 is not cleaved by E. coli RNase III
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
reduces expression of itself
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
mRNA phage SP82 is not cleaved by E. coli RNase III
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
RNAI, a regulator of plasmid replication is cleaved
-
-
?
mRNA transcripts + H2O
5'-phosphooligonucleotides
-
to affect gene expression
-
-
?
pre-mRNA + H2O
mature mRNA
-
enzyme regulates gene expression by controlling mRNA translation and stability
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
enzyme is required for processing
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-rRNA + H2O
mature rRNA
-
double-stranded RNA regions in the 3'external transcribed spacer capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
enzyme is required for processing
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snoRNA + H2O
mature snoRNA
-
i.e. small nucleolar RNA, double-stranded RNA regions in intergenic spacers of polycistronic snoRNA transcription units capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
enzyme is required for processing
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
pre-snRNA + H2O
mature snRNA
-
i.e. small nuclear RNA, double-stranded RNA regions in the 5'- or 3'-end flanking sequences capped by terminal AGNN tetraloops determine the cleavage specificity
-
-
?
R1.1 RNA + H2O
2 fragments of R1.1 RNA
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
2 fragments of R1.1 RNA
-
substrate is enzymatically synthesized based on the R1.1 processing signal, which is encoded in the phage T7 genetic early regionbetween genes 1.0 and 1.1, 1 cleavage site
-
-
?
R1.1 RNA + H2O
?
R1.1 is a structured 60 nucleotides (nt)-long RNA molecule containing an asymmetric (4 nt/5 nt) internal loop, and it comes from the phage T7 early region between genes 1.0 and 1.1. This RNA contains an RNase III primary cleavage site (a) that is recognized in vivo and in vitro, and a secondary site (b) that is cleaved only in vitro. RNase III is known to cleave R1.1 at these two preferred sites (a and b) in a metal cofactor-dependent manner. Strictly metal cofactor-dependent activity of SmRNase III on the model R1.1 substrate
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, recombinant substrate from in vitro transcription, determination of cleaving positions for the recombinant hybrid enzyme mutants
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, several derivatives containing an internal loop
product determination
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, substrate possesses 2 ethidium bromide binding sites in the internal loop and the lower stem, respectively, both consisting of an A-A pair stacked on a CG pair, which is a motif that is a favourable environment for intercalation
-
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
Paramecium bursaria Chlorella virus-1
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, several cleavage sites
product determination
-
?
R1.1 RNA + H2O
fragments of R1.1 RNA
-
based on the R1.1 processing signal, which is encoded in the phage T7 genetic early region between genes 1.0 and 1.1, recombinant substrate from in vitro transcription, determination of cleaving positions for the recombinant hybrid enzyme mutants
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
no activity on 23S RNA and 16S RNA
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
the small and stable 10Sa RNA is cleaved
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
23S RNA in Rhodobacter capsulatus
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
initiates maturation of 23S and 16S RNA species
-
-
?
ribosomal RNA + H2O
smaller precursor rRNA
-
23S RNA in Rhodobacter capsulatus
-
-
?
RNA + H2O
?
RNA substrate tested are U5, U2, Mig2, and Yta6. Comparison between the association and dissociation kinetics of Mig2 and U5 products indicated that Mig2 products have a 2fold higher association rate and an 8fold lower dissociation rate. The reactivity of Rnt1p substrates is defined by the basepairing of the cleavage site, substrate specificity, overview
-
-
?
RNA + H2O
?
RNA substrate tested are U5, U2, Mig2, and Yta6. Comparison between the association and dissociation kinetics of Mig2 and U5 products indicated that Mig2 products have a 2fold higher association rate and an 8fold lower dissociation rate. The reactivity of Rnt1p substrates is defined by the basepairing of the cleavage site, substrate specificity, overview
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
E. coli infected with bacteriophage T4 deletion mutant
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
?
single-stranded RNA + H2O
5'-phosphooligonucleotides
-
-
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
initiates maturation of phage T4 tRNA
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
five additional secondary cleavage sites in RNA A3t from bacteriophage T7
-
-
?
tRNA + H2O
5'-phosphooligonucleotides
-
HIV-1 RT displays the same cleavage specificity as RNase D
-
-
?
additional information
?
-
cleave internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
cleave internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
small hairpins based on the stem structures associated with the Aquifex 16S and 23S rRNA precursors are cleaved at sites that are consistent with production of the immediate precursors to the mature rRNAs. Substrate reactivity is independent of the distal box sequence, but is strongly dependent on the proximal box sequence. RNase III mechanism of dsRNA cleavage, overview
-
-
?
additional information
?
-
-
required for 3external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo
-
-
?
additional information
?
-
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
?
additional information
?
-
-
mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes
-
-
?
additional information
?
-
-
txpA and RatA form an extended hybrid that is a substrate for RNase III cleavage
-
-
?
additional information
?
-
-
Dicer functions as a dsRNA-processing enzyme, producing small interfering RNA (siRNA). Dicer plays important roles in RNA processing, posttranscriptional gene expression control, and defense against virus infection. Bacterial RNase III functions not only as a processing enzyme, but also as a binding protein that binds dsRNA without cleaving it
-
-
?
additional information
?
-
-
RNase III creates the substrate for PNPase that degrades the small RNA37, thus destroying the double-stranded 5' stem
-
-
?
additional information
?
-
cleavage of an artificial 23S rRNA stem-loop substrate by the wild-type enzyme. The sequence is composed of the double-stranded stem portion of the Borrelia burgdorferi 23S rRNA transcript with a loop of four unmatched nucleotides. Modelling for rRNA processing, overview
-
-
?
additional information
?
-
-
cleavage of an artificial 23S rRNA stem-loop substrate by the wild-type enzyme. The sequence is composed of the double-stranded stem portion of the Borrelia burgdorferi 23S rRNA transcript with a loop of four unmatched nucleotides. Modelling for rRNA processing, overview
-
-
?
additional information
?
-
-
analysis of the ability of different metal ions and substrates to support the activity of RNase III in vitro, overview. Brucella melitensis sRNA and Homo sapiens pre-miRNAs as substrates: BM-pri-0015, BM-pre-0015, Has-let-7a-1, and Has-mir-16-1, transcripted by standard T7 transcription kit with [alpha-32P]-UTP labeling. BM-pri-0015 is 300 nt in length, while BM-pre-0015, Has-let-7a-1, and Has-mir-16-1 are about 70 nt. All the transcript sequences are featured with stem-loop structures. Bm-RNase III can not only bind prokaryotic sRNA, but also bind eukaryotic pre-miRNAs
-
-
?
additional information
?
-
-
analysis of the ability of different metal ions and substrates to support the activity of RNase III in vitro, overview. Brucella melitensis sRNA and Homo sapiens pre-miRNAs as substrates: BM-pri-0015, BM-pre-0015, Has-let-7a-1, and Has-mir-16-1, transcripted by standard T7 transcription kit with [alpha-32P]-UTP labeling. BM-pri-0015 is 300 nt in length, while BM-pre-0015, Has-let-7a-1, and Has-mir-16-1 are about 70 nt. All the transcript sequences are featured with stem-loop structures. Bm-RNase III can not only bind prokaryotic sRNA, but also bind eukaryotic pre-miRNAs
-
-
?
additional information
?
-
-
enzyme is essential, and is involved in RNA interference, i.e. RNAi, a post-transcriptional gene-silencing phenomenon, and germ line development
-
-
?
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
Dicer-1 and Dicer-2 show different substrate specificity in vivo: Dicer-2 generates small interfering RNAs, siRNAs, from long double-stranded RNA, dsRNA, whereas Dicer-1 produces microRNAs, miRNAs, from pre-miRNA. Dicer-2 can efficiently cleave pre-miRNA in vitro, but phosphate and the Dicer-2 partner protein R2D2 inhibit pre-miRNA cleavage in vivo. Wild-type Dicer-2, but not a mutant defective in ATP hydrolysis, can generate siRNAs faster than it can dissociate from a long dsRNA substrate. Dicer-1 does not efficiently process long dsRNA
-
-
?
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA inmammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as amechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
?
additional information
?
-
-
involved in the maturation of the ribosomal RNA precursor, and bacteriophage T7 mRNA precursors, enzyme participates in the degradation as well as maturation of diverse cellular, phage, and plasmid RNAs
-
-
?
additional information
?
-
-
no activity with (rA)25, (rU)25, (rC)25, dsDNA, ssDNA and an RNA-DNA hybrid
-
-
?
additional information
?
-
-
RNA structure-dependent uncoupling of substrate recognition and cleavage, in vitro selection and structure determination of cleavage resistant variants of T7 R1.1 RNA classes I and II, due to altered conformation, overview
-
-
?
additional information
?
-
-
specificity for A-form dsRNA, enzyme is loosely associated with ribosomes
-
-
?
additional information
?
-
-
substrate specificity of the recombinant hybrid enzyme mutants, substrate specificity is determined by the catalytic N-terminus of the enzyme
-
-
?
additional information
?
-
-
substrate specificity with diverse RNA mutant substrate variants, the RNA internal loop, in which is located the required single scissile phosphodiester, is the reactivity epitope the substrates, overview
-
-
?
additional information
?
-
as a binding protein, RNase III binds and stabilizes certain RNAs, thus suppressing the expression of certain genes
-
-
?
additional information
?
-
-
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
substrate is bdm mRNA with recombinant His-tagged RNase III. Introduction of random mutations at the RNase III cleavages sites in bdm mRNA alter the enzyme activity, secondary structures and the stability of hairpins containing the RNase III cleavage sites 3 and 4-II, and RNase II cleavage patterns, overview
-
-
?
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
?
additional information
?
-
-
RNase III specifically processes the proU mRNA within a conserved secondary structure extending from position +203 to +293 of the transcript
-
-
?
additional information
?
-
-
the enzyme cleaves the proU operon transcript reducing its half-life from 65 sec to 4 sec, the rapid degradation ensures efficient inhibition of proU expression and further uptake of osmoprotectants. Processing of dsRNA, product release is the rate-limiting step in the catalytic pathway
-
-
?
additional information
?
-
-
the enzyme cleaves betT and proU mRNA. Introdution of nucleotide substitutions C33U and C39U in thhe enzymes' cleavage sites of betT mRNA inhibit the enzyme activity
-
-
?
additional information
?
-
the enzyme is active with DAPI-enriched pre-rRNA fragments
-
-
?
additional information
?
-
identification of the cleavage targets of the endonucleolytic enzyme at a transcriptome-wide scale and delineation of its in vivo cleavage rules, overview. Usage of tailored RNA-seq-based technology, which allows transcriptome-wide mapping of RNase III cleavage sites at a nucleotide resolution establishing a cleavage pattern of a double cleavage in an intra-molecular stem structure, leaving 2-nt-long 3' overhangs, and refines the base-pairing preferences in the cleavage site vicinity. The two stem positions between the cleavage sites are highly base-paired, usually involving at least one G-C or C-G base pair. A clear distinction between intra-molecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
-
-
?
additional information
?
-
bdm, corA, mltD, proU, betT, and proP mRNAs are used as RNase III substrates, cleavage site determination reveals that no distinct consensus sequences, which would account for the specificity of RNase III recognition and cleavage process, are observed when in vivo RNase III substrates are analyzed
-
-
?
additional information
?
-
-
bdm, corA, mltD, proU, betT, and proP mRNAs are used as RNase III substrates, cleavage site determination reveals that no distinct consensus sequences, which would account for the specificity of RNase III recognition and cleavage process, are observed when in vivo RNase III substrates are analyzed
-
-
?
additional information
?
-
identification of RNase III cleavage sites and generation of a map of the cleavage sites in both intra-molecular and intermolecular duplex substrates. The recognition of DC targets by RNase III is highly specific
-
-
?
additional information
?
-
predicted secondary structure of substrates' RNase III sites, overview
-
-
?
additional information
?
-
ribonuclease III site-specifically cleaves double-stranded(ds) structures in diverse cellular, plasmid and phage RNAs. The catalytic sites employ Mg2+ ions to hydrolyze phosphodiesters, providing products with two-nucleotide, 3'-overhangs and 5'-phosphomonoester, 3'-hydroxyl termini
-
-
?
additional information
?
-
-
ribonuclease III site-specifically cleaves double-stranded(ds) structures in diverse cellular, plasmid and phage RNAs. The catalytic sites employ Mg2+ ions to hydrolyze phosphodiesters, providing products with two-nucleotide, 3'-overhangs and 5'-phosphomonoester, 3'-hydroxyl termini
-
-
?
additional information
?
-
-
RNase III is a double-stranded RNA-specific endoribonuclease that processes and degrades numerous mRNA molecules in Escherichia coli, it acts on mltD mRNA, which encodes membrane-bound lytic murein transglycosylase D. Introduction of a nucleotide substitution at the identified RNase III cleavage sites inhibited RNase III cleavage activity on mltD mRNA, resulting in, consequently, approximately two-fold increase in the steady-state level of the mRNA
-
-
?
additional information
?
-
identification of the cleavage targets of the endonucleolytic enzyme at a transcriptome-wide scale and delineation of its in vivo cleavage rules, overview. Usage of tailored RNA-seq-based technology, which allows transcriptome-wide mapping of RNase III cleavage sites at a nucleotide resolution establishing a cleavage pattern of a double cleavage in an intra-molecular stem structure, leaving 2-nt-long 3' overhangs, and refines the base-pairing preferences in the cleavage site vicinity. The two stem positions between the cleavage sites are highly base-paired, usually involving at least one G-C or C-G base pair. A clear distinction between intra-molecular stem structures that are RNase III substrates and intra-molecular stem structures randomly selected across the transcriptome, emphasizing the in vivo specificity of RNase III
-
-
?
additional information
?
-
identification of RNase III cleavage sites and generation of a map of the cleavage sites in both intra-molecular and intermolecular duplex substrates. The recognition of DC targets by RNase III is highly specific
-
-
?
additional information
?
-
-
the enzyme processes betT and proU mRNA
-
-
?
additional information
?
-
-
the enzyme cleaves betT and proU mRNA. Introdution of nucleotide substitutions C33U and C39U in thhe enzymes' cleavage sites of betT mRNA inhibit the enzyme activity
-
-
?
additional information
?
-
predicted secondary structure of substrates' RNase III sites, overview
-
-
?
additional information
?
-
processing of dsRNA, the PAZ domain specifically recognizes the 2-nt, 3'-overhangs of a processed dsRNA terminus
-
-
?
additional information
?
-
Dicer substrate recognition and specificity, overview
-
-
?
additional information
?
-
-
substrate is dsRNA specific to the HvAV-3e Bro11 and GFP genes. For small RNA cleavage, siRNA duplexes 21 nucleotides in length is used. The sequences of the oligonucleotides are the siRNA duplex-25 GUCCGGAUACUCUUUGCGGAC and siRNA duplex-11 GGAGGAAGAAAGGAGAAAGGA
-
-
?
additional information
?
-
-
ability of Dicer C-terminus to interact with 5-lipoxygenase
-
-
?
additional information
?
-
two-step cleavage of hairpin RNA with 5' overhangs
-
-
?
additional information
?
-
-
two-step cleavage of hairpin RNA with 5' overhangs
-
-
?
additional information
?
-
recombinant DICER protein processes a hairpin RNA with 5' overhangs in vitro and generates an intermediate duplex with a 29 nt-5' strand and a 23 nt-3' strand. Longer 5' overhangs with stable stem structures can reduce the efficiency or rate of substrate cleavage. In vitro two-step processing of the 5'-end labelled pre-mmu-mir-1982 RNA by recombinant DICER protein, overview
-
-
?
additional information
?
-
-
recombinant DICER protein processes a hairpin RNA with 5' overhangs in vitro and generates an intermediate duplex with a 29 nt-5' strand and a 23 nt-3' strand. Longer 5' overhangs with stable stem structures can reduce the efficiency or rate of substrate cleavage. In vitro two-step processing of the 5'-end labelled pre-mmu-mir-1982 RNA by recombinant DICER protein, overview
-
-
?
additional information
?
-
-
Drosha recognizes the short internal stem-loop structure of long primary-microRNA transcript as part of a microprocessor complex and cleaves it at the base of the stem-loop, releasing it from the flanking single-stranded regions. Cleavage of both arms of the stem-loop is dependent on the tandem RNase III domains of Drosha binding and cleaving the dsRNA stem. The released stem-loop structure is exported from the nucleus by exportin 5 and is known as a pre-miRNA. Once in the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs. Drosha recognizes and cleaves stem-loop structures within the 50 end of the Dgcr8mRNA in mammalian cells, leading to destabilization of the mRNA. This cleavage therefore serves as a mechanism of gene repression, and is proposed to autoregulate the microprocessor complex
-
-
?
additional information
?
-
-
processing of dsRNA. Drosha acts on primary transcripts synthesized by RNA polymerase II that typically contain several miRNAs. Site-specific cleavage within irregular, extended hairpin structures (pri-miRNAs) creates the pre-miRNAs that then are delivered by Exportin5 to the cytoplasm for final maturation by Dicer. Drosha functions within a complex termed the microprocessor that contains a protein, DGCR8, that is required for Drosha action
-
-
?
additional information
?
-
-
Drosha cleavage site analysis, reactivity determinants of a pri-miRNA substrate for Drosha, and a proposed DGCR8-dsRNA interaction, and Dicer substrate recognition and specificity, overview
-
-
?
additional information
?
-
Dicer protein binds to target RNA through an asRNA and induces the cleavage of target RNA
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
In the cytoplasm the pre-miRNA is cleaved by Dicer, in complex with another dsRNA-binding protein, Trbp. The PAZ domain of Dicer binds the basal end of the double-stranded pre-miRNA, and guides the stem into a cleft formed by the intramolecular dimerization of two RNase III domains. Scission of the RNA removes the loop structure, leaving a miRNA duplex. The distance from the PAZ domain to the RNase III domain dimer is thought to define the length of the RNA product, typically approximately 22 nt for miRNAs
-
-
?
additional information
?
-
the recombinant RNase III from Bacillus Calmette Guerin (BCG-RNase III) cleaves small hairpin RNA based on the conserved stem structure associated with Mycobacterium 16S ribosomal RNA precursor at specific sites, remnant endogenous ribonucleases from the expression host have no effect on cleavage assays. BCG-16S [hp] RNA is synthesized using 2.5 U/ml T7 RNA polymerase at 42°C for 4 h. The specific activity of the alpha-32P-UTP in the transcription reactions is 200 Ci/mol
-
-
?
additional information
?
-
Mycobacterium tuberculosis variant bovis Pasteur 1173P2
the recombinant RNase III from Bacillus Calmette Guerin (BCG-RNase III) cleaves small hairpin RNA based on the conserved stem structure associated with Mycobacterium 16S ribosomal RNA precursor at specific sites, remnant endogenous ribonucleases from the expression host have no effect on cleavage assays. BCG-16S [hp] RNA is synthesized using 2.5 U/ml T7 RNA polymerase at 42°C for 4 h. The specific activity of the alpha-32P-UTP in the transcription reactions is 200 Ci/mol
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
phylogenetic analysis, enzyme might be important for virus replication
-
-
?
additional information
?
-
Paramecium bursaria Chlorella virus-1
-
substrate cleavage specificity
-
-
?
additional information
?
-
-
substrate specificity of the recombinant hybrid enzyme mutants, substrate specificity is determined by the catalytic N-terminus of the enzyme
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
enzyme is involved in RNA processing and RNA interference, i.e. RNAi, regulation by a combination of primary and tertiary structural elements allowing a substrate-specific binding and cleavage efficiency
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
additional information
?
-
-
substrate specificity, overview, RNA substrate with introduced sequences stabilizing the RNA helix enhances binding while the turnover rate is reduced, thus substrate binding becomes rate-limiting
-
-
?
additional information
?
-
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
?
additional information
?
-
-
the enzyme plays an important role in the maturation of a diverse set of RNAs
-
-
?
additional information
?
-
-
specificity of cleavage by Rnt1p relies on the presence of RNA tetraloop structures with the consensus sequence AGNN at the top of the target dsRNA. Identification of exocyclic groups of purines in the major groove downstream of the tetraloop as a major antideterminant in RNase III activity
-
-
?
additional information
?
-
design of series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate is engineered to carry a single or multiple 2'-O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Introduction of 2'-O-methyl ribonucleotides near the cleavage site increases the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'-O-methyl ribonucleotides inhibits cleavage while single 2'-fluoro ribonucleotide substitutions does not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated
-
-
?
additional information
?
-
-
design of series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate is engineered to carry a single or multiple 2'-O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Introduction of 2'-O-methyl ribonucleotides near the cleavage site increases the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'-O-methyl ribonucleotides inhibits cleavage while single 2'-fluoro ribonucleotide substitutions does not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated
-
-
?
additional information
?
-
-
Rnt1p, the major RNase III in Saccharomyces cerevisiae, cleaves RNA substrates containing hairpins capped by A/uGNN tetraloops, using its double-stranded RNA binding domains, dsRBD, to recognize a conserved tetraloop fold. The dsRBD adopts the same conformation in both the AAGU and AGAA complexes
-
-
?
additional information
?
-
-
the AAGU hairpin binds to and is efficiently cleaved by Rnt1p in the context of the snR47 stem sequence
-
-
?
additional information
?
-
-
processing of dsRNA, specific bp sequence elements can modulate substrate reactivity, and a network of hydrogen bonds provides an energetically important contribution to Rnt1p binding, a phylogenetic-based substrate alignment analysis reveals a statistically significant exclusion of the UA bp from the position adjacent to the tetraloop. Rnt1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways. The enzyme also interacts with Gar1p, a protein involved in pseudouridylation reactions, via its C-terminal portion adjacent to the dsRBD
-
-
?
additional information
?
-
-
the enzyme processes ribosomal RNA, small nucleolar RNA, small nuclear RNA, and messenger RNA
-
-
?
additional information
?
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
?
additional information
?
-
-
mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
?
additional information
?
-
the catalytic efficiency of yeast ribonuclease III depends on substrate specific product release rate. Development of a real-time FRET assay for the detection of dsRNA degradation by yeast RNase III (Rnt1p) and detection of kinetic bottlenecks controlling the reactivity of different substrates. Rnt1p cleavage reaction is not only limited by the rate of catalysis but can also depend on base-pairing of product termini. Cleavage products terminating with paired nucleotides, like the degradation signals found in coding mRNA sequence, were less reactive and more prone to inhibition than products having unpaired nucleotides found in noncoding RNA substrates
-
-
?
additional information
?
-
-
the catalytic efficiency of yeast ribonuclease III depends on substrate specific product release rate. Development of a real-time FRET assay for the detection of dsRNA degradation by yeast RNase III (Rnt1p) and detection of kinetic bottlenecks controlling the reactivity of different substrates. Rnt1p cleavage reaction is not only limited by the rate of catalysis but can also depend on base-pairing of product termini. Cleavage products terminating with paired nucleotides, like the degradation signals found in coding mRNA sequence, were less reactive and more prone to inhibition than products having unpaired nucleotides found in noncoding RNA substrates
-
-
?
additional information
?
-
the enzyme Rnt1p binds to RNA stems capped with an NGNN tetraloop, via specific interactions between a structural motif located at the end of the Rnt1p dsRNA-binding domain and the guanine nucleotide in the second position of the loop
-
-
?
additional information
?
-
mode of substrate recognition by the enzyme, which has a unique RNA-binding motif, the enzyme interacts with the RNA stem upstream of the cleavage sites, structure-function analysis, detailed overview. Interaction between the N-terminal domain and RNA increases precision of cleavage site selection
-
-
?
additional information
?
-
the catalytic efficiency of yeast ribonuclease III depends on substrate specific product release rate. Development of a real-time FRET assay for the detection of dsRNA degradation by yeast RNase III (Rnt1p) and detection of kinetic bottlenecks controlling the reactivity of different substrates. Rnt1p cleavage reaction is not only limited by the rate of catalysis but can also depend on base-pairing of product termini. Cleavage products terminating with paired nucleotides, like the degradation signals found in coding mRNA sequence, were less reactive and more prone to inhibition than products having unpaired nucleotides found in noncoding RNA substrates
-
-
?
additional information
?
-
-
in vitro RNase III is active with MicA when it is in complex with its targets, ompA or lamB mRNAs. MicA is cleaved by RNase III in a coupled way with ompA mRNA
-
-
?
additional information
?
-
-
RNase III cleaves dsRNA
-
-
?
additional information
?
-
-
processing of dsRNA. Pac1p cleaves hairpin structures in pre-rRNAs, pre-mRNAs, and transcripts containing noncoding RNAs such as snoRNAs, as part of the respective maturation pathways
-
-
?
additional information
?
-
enzyme SmRNase III is double-strand specific and exhibits different preference for endogenous RNA substrates
-
-
?
additional information
?
-
-
enzyme SmRNase III is double-strand specific and exhibits different preference for endogenous RNA substrates
-
-
?
additional information
?
-
-
RNAIII and the endoribonuclease III coordinately regulate spa gene expression
-
-
?
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
?
additional information
?
-
-
enzyme RNase III cleavage produces RNA fragments with 5'-phosphate and 3'-hydroxyl termini and a two-nucleotide 3'-overhang. The 5' untranslated region of cspA mRNA is processed by the enzyme. Determination of substrate specificity by sequencing on cDNA libraries generated from RNAs that are co-immunoprecipitated with wild-type RNase III or two different cleavage-defective mutant variants D63A and E135A in vivo, validation of several RNA targets and mapping of cleavage sites of wild-type and mutant enzymes, detailed overview
-
-
?
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
?
additional information
?
-
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
Streptococcus pyogenes serotype 14
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
Streptococcus pyogenes serotype 14 HSC5
-
the endoribonuclease RNase III cleaves double-stranded RNAs, which can be formed during the interaction between an sRNA and target mRNAs
-
-
?
additional information
?
-
development of a method, called identification of specific cleavage position (ISCP), which enables the identification of direct endoribonuclease targets in vivo by comparing the 5' and 3' ends of processed transcripts between wild-type and RNase-deficient strains. The double-stranded specific RNase III in the human pathogen Streptococcus pyogenes is used as a model. Mapping of 92 specific cleavage positions (SCPs) among which, 48 are previously described and 44 are new, with the characteristic 2 nucleotides 3' overhang of RNase III. Most SCPs are located in untranslated regions of RNAs. Screening for RNase III targets using transcriptomic differential expression analysis (DEA) and comparison with the RNase III targets identified using the ISCP method. Method evaluation, overview. pre-rRNA maturation by RNase III
-
-
?
additional information
?
-
Streptococcus pyogenes serotype M1 SF370 (M1GAS)
development of a method, called identification of specific cleavage position (ISCP), which enables the identification of direct endoribonuclease targets in vivo by comparing the 5' and 3' ends of processed transcripts between wild-type and RNase-deficient strains. The double-stranded specific RNase III in the human pathogen Streptococcus pyogenes is used as a model. Mapping of 92 specific cleavage positions (SCPs) among which, 48 are previously described and 44 are new, with the characteristic 2 nucleotides 3' overhang of RNase III. Most SCPs are located in untranslated regions of RNAs. Screening for RNase III targets using transcriptomic differential expression analysis (DEA) and comparison with the RNase III targets identified using the ISCP method. Method evaluation, overview. pre-rRNA maturation by RNase III
-
-
?
additional information
?
-
-
maturation of repeat/spacer-derived short crRNAs by RNase III and the CRISPR-associated Csn1 protein. The co-processed tracrRNA and pre-crRNA carry short 3' overhangs reminiscent of cleavage by the endoribonuclease RNase III
-
-
?
additional information
?
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
Streptomyces coelicolor absB gene encodes an RNase III family endoribonuclease and is essential for antibiotic biosynthesis. AbsB controls its own expression by sequentially and site specifically cleaving stem-loop segments of its polycistronic transcript
-
-
?
additional information
?
-
-
the gene encoding RNase III in Streptomyces coelicolor is transcribed during exponential phase and is required for antibiotic production and for proper sporulation
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
RNase III digests mRNA transcripts of genes SCO3982 to SCO3988 and SCO5737 unattended (i.e. without asRNA), whereas another unattended transcript, of gene SCO0762, is not cleaved. Determination of asRNAs to mRNAs that bind RNase III in vitro, overview
-
-
?
additional information
?
-
globally regulates the production of antibiotics by Streptomyces coelicolor. Antibiotic production by wild-type and mutant strains of Streptomyces coelicolor analyzed
-
-
?
additional information
?
-
-
the class 1 enzyme binds and processes small dsRNA molecules, it can cleave long dsRNA molecules, synthetic small interfering RNAs (siRNAs), and plant- and virus-derived siRNAs extracted from sweet potato plants
-
-
?
additional information
?
-
-
the enzyme cleaves ds-siRNAs and microRNAs (miRNAs) with a regular A-form conformation, while asymmetrical bulges, extensive mismatches and 2'-O-methylation of ds-siRNA and miRNA interfer with processing, substrate specifiicty of the enzyme in processing small RNA duplexes, overview
-
-
?
additional information
?
-
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
cleaves internally 32P-labeled R1.1(WC) RNA
-
-
?
additional information
?
-
-
substrate specificity with RNA duplex substrates, overview. The proximal box is a primary reactivity epitope for Tm-23S[hp] RNA. a CG or GC bp substitution at pb position 2 reduces the relative reactivity to 0.1 and 0.3, respectively, while a CG or GC substitution at pb position 4 provides a relative reactivity of 0.1 or 0.4, respectively. At pb position 3, only the AU bp substitution causes a significant drop in relative reactivity, while none of the bp substitutions at pb position 1 has a significant effect
-
-
?
additional information
?
-
-
endonuclease mRPN1 directly binds with TbRGG2 and exhibits a nuclease-resistant association with two more proteins, 4160 and 8170, it might modulate gRNA utilization by editing complexes
-
-
?
additional information
?
-
-
recombinant mRPN1 is a dimeric dsRNA-dependent endonuclease that generates 2-nucleotide 3' overhangs, cleavage specificity of mRPN1 is reminiscent of bacterial RNase III and thus is fundamentally distinct from editing endonucleases, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other species, overview
-
-
?
additional information
?
-
-
enzyme is required for maturation of pre-rRNAs
-
-
?
additional information
?
-
-
determination and analysis of processing signals within the secondary structure of pre-RNA substrates, comparison with the sequences and structure of RNA from other hemiascomycetes species, overview
-
-
?
